CENPN (NM_001100624) Human Untagged Clone

CAT#: SC316725

CENPN (untagged)-Human centromere protein N (CENPN), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CENPN
• Synonyms: BM039; C16orf60; CENP-N; ICEN32
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC316725 representing NM_001100624.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGATGAGACTGTTGCTGAGTTCATCAAGAGGACCATCTTGAAAATCCCCATGAATGAACTGACAACA
  ATCCTGAAGGCCTGGGATTTTTTGTCTGAAAATCAACTGCAGACTGTAAATTTCCGACAGAGAAAGGAA
  TCTGTAGTTCAGCACTTGATCCATCTGTGTGAGGAAAAGCGTGCAAGTATCAGTGATGCTGCCCTGTTA
  GACATCATTTATATGCAATTTCATCAGCACCAGAAAGTTTGGGAAGTTTTTCAGATGAGTAAAGGACCA
  GGTGAAGATGTTGACCTTTTTGATATGAAACAATTTAAAAATTCGTTCAAGAAAATTCTTCAGAGAGCA
  TTAAAAAATGTGACAGTCAGCTTCAGAGAAACTGAGGAGAATGCAGTCTGGATTCGAATTGCCTGGGGA
  ACACAGTACACAAAGCCAAACCAGTACAAACCTACCTACGTGGTGTACTACTCCCAGACTCCGTACGCC
  TTCACGTCCTCCTCCATGCTGAGGCGCAATACACCGCTTCTGGGTCAGGCGCTGACAATTGCTAGCAAA
  CACCATCAGATTGTGAAAATGGACCTGAGAAGTCGGTATCTGGACTCTCTTAAGGCTATTGTTTTTAAA
  CAGTATAATCAGACCTTTGAAACTCACAACTCTACGACACCTCTACAGGAAAGAAGCCTTGGACTAGAT
  ATAAATATGGATTCAAGGATCATTCATGAAAACATAGTAGAAAAAGAGAGAGTCCAACGAATAACTCAA
  GAAACATTTGGAGATTATCCTCAACCACAACTAGAATTTGCACAATATAAGCTTGAAACGAAATTCAAA
  AGTGGTTTAAATGGGAGCATCTTGGCTGAGAGGGAAGAACCCCTCCGATGCCTAATAAAGTTCTCTAGC
  CCACATCTTCTGGAAGCATTGAAATCCTTAGCACCAGCGGGTATTGCAGATGCTCCACTTTCTCCACTG
  CTCACTTGCATACCCAACAAGAGAATGAATTATTTTAAAATTAGAGATAAATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001100624
• Insert Size: 1020 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001100624.2
• RefSeq Size: 4663 bp
• RefSeq ORF: 1020 bp
• Locus ID: 55839
• UniProt ID: Q96H22
• Cytogenetics: 16q23.2
• Protein Families: Druggable Genome
• MW: 39.6 kDa
• Gene Summary: The protein encoded by this gene forms part of the nucleosome-associated complex and is important for kinetochore assembly. It is bound to kinetochores during S phase and G2 and recruits other proteins to the centromere. Pseudogenes of this gene are located on chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (2) uses an alternate 3' terminal exon compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.