Fucose mutarotase (FUOM) (NM_001098483) Human Untagged Clone

CAT#: SC316335

FUOM (untagged)-Human chromosome 10 open reading frame 125 (C10orf125), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Fucose mutarotase
• Synonyms: C10orf125; FucM; FUCU
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC316335 representing NM_001098483.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGTGGCGCTGAAGGGTGTCCCCGCACTGCTGTCCCCCGAGCTGCTCTACGCGCTGGCGCGGATGGGG
  CACGGGGACGAGATCGTTCTTGCGGACTTGAACTTCCCGGCCTCCTCCATCTGCCAGTGTGGGCCCATG
  GAGATCCGTGCAGACGGCCTGGGCATCCCGCAGCTCCTGGAGGCCGTGCTGAAGCTGCTGCCCCTGGAC
  ACCTATGTGGAGAGTCCGGCTGCAGTCATGGAGCTGGTGCCCAGCGACAAGGAGAGGGGCCTGCAGACC
  CCAGTGTGGACGGAGTACGAGTCCATCCTACGCAGGGCCGGCTGTGTGAGAGCCCTGGCAAAGATAGAG
  AGGTTTGAGTTTTATGAACGGGCTAAGAAGGCTTTTGCTGTTGTGGCAACGGGGGAGACGGCCCTCTAC
  GGAAACCTCATCCTCAGGAAGGGGGTGCTTGCCCTCAACCCCCTGCTGTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001098483
• Insert Size: 465 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001098483.1
• RefSeq Size: 699 bp
• RefSeq ORF: 465 bp
• Locus ID: 282969
• UniProt ID: A2VDF0
• Cytogenetics: 10q26.3
• MW: 16.8 kDa
• Gene Summary: Involved in the interconversion between alpha- and beta-L-fucoses. L-Fucose (6-deoxy-L-galactose) exists as alpha-L-fucose (29.5%) and beta-L-fucose (70.5%), the beta-form is metabolized through the salvage pathway. GDP-L-fucose formed either by the de novo or salvage pathways is transported into the endoplasmic reticulum, where it serves as a substrate for N- and O-glycosylations by fucosyltransferases. Fucosylated structures expressed on cell surfaces or secreted in biological fluids are believed to play a critical role in cell-cell adhesion and recognition processes.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) encodes the longest isoform (1).