ASRGL1 (NM_001083926) Human Untagged Clone

CAT#: SC316051

ASRGL1 (untagged)-Human asparaginase like 1 (ASRGL1), transcript variant 1


  "NM_001083926" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Goat Polyclonal Antibody against ASRGL1
    • 100 ug

USD 520.00

Other products for "ASRGL1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ASRGL1
Synonyms ALP; ALP1; CRASH
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316051 representing NM_001083926.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAATCCCATCGTAGTGGTCCACGGCGGCGGAGCCGGTCCCATCTCCAAGGATCGGAAGGAGCGAGTG
CACCAGGGCATGGTCAGAGCCGCCACCGTGGGCTACGGCATCCTCCGGGAGGGCGGGAGCGCCGTGGAT
GCCGTAGAGGGAGCTGTCGTCGCCCTGGAAGACGATCCCGAGTTCAACGCAGGTTGTGGGTCTGTCTTG
AACACAAATGGTGAGGTTGAAATGGATGCTAGTATCATGGATGGAAAAGACCTGTCTGCAGGAGCAGTG
TCCGCAGTCCAGTGTATAGCAAATCCCATTAAACTTGCTCGGCTTGTCATGGAAAAGACACCTCATTGC
TTTCTGACTGACCAAGGCGCAGCGCAGTTTGCAGCAGCTATGGGGGTTCCAGAGATTCCTGGAGAAAAA
CTGGTGACAGAGAGAAACAAAAAGCGCCTGGAAAAAGAGAAGCATGAAAAAGGTGCTCAGAAAACAGAT
TGTCAAAAAAACTTGGGAACCGTGGGTGCTGTTGCCTTGGACTGCAAAGGGAATGTAGCCTACGCAACC
TCCACAGGCGGTATCGTTAATAAAATGGTCGGCCGCGTTGGGGACTCACCGTGTCTAGGAGCTGGAGGT
TATGCCGACAATGACATCGGAGCCGTCTCAACCACAGGGCATGGGGAAAGCATCCTGAAGGTGAACCTG
GCTAGACTCACCCTGTTCCACATAGAACAAGGAAAGACGGTAGAAGAGGCTGCGGACCTATCGTTGGGT
TATATGAAGTCAAGGGTTAAAGGTTTAGGTGGCCTCATCGTGGTTAGCAAAACAGGAGACTGGGTGGCA
AAGTGGACCTCCACCTCCATGCCCTGGGCAGCCGCCAAGGACGGCAAGCTGCACTTCGGAATTGATCCT
GACGATACTACTATCACCGACCTTCCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001083926
Insert Size 927 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001083926.1
RefSeq Size 2424 bp
RefSeq ORF 927 bp
Locus ID 80150
UniProt ID Q7L266
Cytogenetics 11q12.3
Protein Families Protease
MW 32.1 kDa
Gene Summary Has both L-asparaginase and beta-aspartyl peptidase activity. May be involved in the production of L-aspartate, which can act as an excitatory neurotransmitter in some brain regions. Is highly active with L-Asp beta-methyl ester. Besides, has catalytic activity toward beta-aspartyl dipeptides and their methyl esters, including beta-L-Asp-L-Phe, beta-L-Asp-L-Phe methyl ester (aspartame), beta-L-Asp-L-Ala, beta-L-Asp-L-Leu and beta-L-Asp-L-Lys. Does not have aspartylglucosaminidase activity and is inactive toward GlcNAc-L-Asn. Likewise, has no activity toward glutamine.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.