PTOP (ACD) (NM_001082487) Human Untagged Clone

CAT#: SC316006

ACD (untagged)-Human adrenocortical dysplasia homolog (mouse) (ACD), transcript variant 3


  "NM_001082487" in other vectors (6)

Reconstitution Protocol

USD 788.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
ACD mouse monoclonal antibody, clone OTI2B1 (formerly 2B1)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PTOP"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PTOP
Synonyms PIP1; PTOP; TINT1; TPP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316006 representing NM_001082487.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTGGCCGCTGTCAGAGTGACGCCGCGATGAGAGTAAACGGGCCAGCATCCCGTGCACCAGCGGGG
TGGACCAGCGGGAGTCTGCACACAGGCCCCCGAGCAGGACGCCCTCGTGCGCAGGCGCGGGGTGTACGT
GGGCGGGGCCTCCTCCTCCGGCCCCGCCCAGCGAAGGAGCTTCCTCTTCCGAGGAAAGGCGGGGCCTGG
GCGCCCGCGGGAAACCCGGGCCCGTTGCATCCGCTGGGTGTAGCCGTGGGGATGGCAGGTTCGGGGAGG
CTGGTCCTACGGCCCTGGATTCGGGAGCTGATTCTGGGGTCAGAGACACCCTCCAGTCCACGAGCCGGG
CAGCTGCTTGAGGACGCCGAGGCCGCGGTCGCGGGCCCATCCCACGCCCCTGATACGTCCGACGTCGGG
GCCACGCTGCTTGTGTCTGACGGGACCCACAGTGTCCGATGCCTGGTGACGCGGGAGGCCCTGGACACC
TCGGACTGGGAGGAGAAGGAGTTCGGCTTCCGCGGGACAGAGGGCCGGCTGCTGCTGCTGCAGGACTGC
GGGGTTCATGTCCAGGTCGCTGAGGGCGGCGCGCCCGCAGAGTTCTATCTCCAGGTGGACCGCTTCAGC
CTGCTGCCCACGGAGCAGCCCCGGCTACGGGTGCCTGGTTGCAACCAAGACTTAGATGTTCAGAAAAAG
CTCTATGACTGCCTTGAGGAGCACCTTTCAGAGTCCACCTCGTCCAATGCAGGCCTATCACTGTCCCAG
CTTCTGGATGAAATGCGGGAGGACCAGGAGCATCAGGGGGCACTCGTGTGCCTGGCTGAAAGCTGCCTG
ACACTGGAGGGCCCTTGCACAGCACCCCCTGTCACCCACTGGGCTGCCTCACGATGCAAGGCCACGGGA
GAAGCTGTGTACACTGTCCCCAGCTCAATGCTGTGCATCTCTGAGAATGACCAGCTAATTCTGAGCTCT
CTAGGCCCCTGTCAGAGGACACAGGGCCCTGAGCTGCCCCCACCAGACCCGGCTCTGCAGGACCTATCT
CTGACCCTCATAGCCTCTCCTCCTTCCTCACCCAGTTCCTCAGGAACCCCGGCCTTACCCGGCCACATG
TCATCCGAGGAAAGTGGTACCAGCATCAGCCTTCTGCCTGCCCTGTCCTTGGCTGCTCCAGACCCAGGG
CAGAGAAGCAGCTCCCAGCCCTCACCAGCCATCTGCTCAGCCCCTGCCACCCTGACCCCCAGGTCCCCA
CACGCCAGCCGTACCCCCAGCTCCCCACTCCAGAGCTGCACTCCCAGTCTCTCACCCCGTAGCCATGTC
CCCAGTCCACACCAGGCTCTTGTGACCAGGCCCCAGAAACCTAGCCTGGAGTTCAAGGAGTTTGTAGGG
TTGCCCTGCAAGAATCGGCCGCCTTTTCCCAGGACCGGAGCTACCAGGGGAGCCCAGGAGCCCTGCTCT
GTCTGGTATGAGTATGAGCCACCCTGCACGTCCCTCTGTGCTCGGGTCCAAGCTGTCAGGCTTCCTCCC
CAGCTCATGGCCTGGGCCTTGCACTTTCTGATGGATGCACAGCCAGGGTCTGAGCCAACTCCGATGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001082487
Insert Size 1587 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001082487.1
RefSeq Size 2047 bp
RefSeq ORF 1587 bp
Locus ID 65057
UniProt ID Q96AP0
Cytogenetics 16q22.1
MW 55.9 kDa
Gene Summary This gene encodes a protein that is involved in telomere function. This protein is one of six core proteins in the telosome/shelterin telomeric complex, which functions to maintain telomere length and to protect telomere ends. Through its interaction with other components, this protein plays a key role in the assembly and stabilization of this complex, and it mediates the access of telomerase to the telomere. Multiple transcript variants encoding different isoforms have been found for this gene. This gene, which is also referred to as TPP1, is distinct from the unrelated TPP1 gene on chromosome 11, which encodes tripeptidyl-peptidase I. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) uses alternate in-frame splice sites in the 5' and 3' coding regions, compared to variant 1, resulting in a shorter protein (isoform 3).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.