G6PC2 (NM_001081686) Human Untagged Clone
CAT#: SC315981
G6PC2 (untagged)-Human glucose-6-phosphatase, catalytic, 2 (G6PC2), transcript variant 2
"NM_001081686" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | G6PC2 |
Synonyms | IGRP |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001081686, the custom clone sequence may differ by one or more nucleotides
ATGGATTTCCTTCACAGGAATGGAGTGCTCATAATTCAGCATTTGCAGAAGGACTACCGA GCTTACTACACTTTTCTAAATTTTATGTCCAATGTTGGAGACCCCAGGAATATCTTTTTC ATTTATTTTCCACTTTGTTTTCAATTTAATCAGACAGTTGGAACCAAGATGATATGGGTA GCAGTCATTGGGGATTGGTTAAATCTTATATTTAAATGGATATTATTTGGTCATCGACCT TACTGGTGGGTCCAAGAAACTCAGATTTACCCAAATCACTCAAGTCCATGCCTTGAACAG TTCCCTACTACATGTGAAACAGGTCCAGGAAGTCCATCTGGCCATGCAATGGGCGCATCC TGTGTCTGGTATGTCATGGTAACCGCTGCCCTGAGCCACACTGTCTGTGGGATGGATAAG TTCTCTATCACTCTGCACAGGCATGCTGGTGGCAGAGGCCTT |
Restriction Sites | Please inquire |
ACCN | NM_001081686 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001081686.1, NP_001075155.1 |
RefSeq Size | 2980 bp |
RefSeq ORF | 465 bp |
Locus ID | 57818 |
UniProt ID | Q9NQR9 |
Cytogenetics | 2q31.1 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Adipocytokine signaling pathway, Galactose metabolism, Glycolysis / Gluconeogenesis, Insulin signaling pathway, Metabolic pathways, Starch and sucrose metabolism |
Gene Summary | This gene encodes an enzyme belonging to the glucose-6-phosphatase catalytic subunit family. These enzymes are part of a multicomponent integral membrane system that catalyzes the hydrolysis of glucose-6-phosphate, the terminal step in gluconeogenic and glycogenolytic pathways, allowing the release of glucose into the bloodstream. The family member encoded by this gene is found in pancreatic islets and does not exhibit phosphohydrolase activity, but it is a major target of cell-mediated autoimmunity in diabetes. Several alternatively spliced transcript variants of this gene have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223506 | G6PC2 (Myc-DDK-tagged)-Human glucose-6-phosphatase, catalytic, 2 (G6PC2), transcript variant 2 |
USD 165.00 |
|
RC223506L3 | Lenti-ORF clone of G6PC2 (Myc-DDK-tagged)-Human glucose-6-phosphatase, catalytic, 2 (G6PC2), transcript variant 2 |
USD 465.00 |
|
RC223506L4 | Lenti-ORF clone of G6PC2 (mGFP-tagged)-Human glucose-6-phosphatase, catalytic, 2 (G6PC2), transcript variant 2 |
USD 465.00 |
|
RG223506 | G6PC2 (tGFP-tagged) - Human glucose-6-phosphatase, catalytic, 2 (G6PC2), transcript variant 2 |
USD 365.00 |
{0} Product Review(s)
Be the first one to submit a review