TAFA5 (NM_001082967) Human Untagged Clone

CAT#: SC315980

FAM19A5 (untagged)-Human family with sequence similarity 19 (chemokine (C-C motif)-like), member A5 (FAM19A5), transcript variant 1


  "NM_001082967" in other vectors (4)

Reconstitution Protocol

USD 165.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "TAFA5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TAFA5
Synonyms FAM19A5; QLLK5208; TAFA-5; UNQ5208
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001082967, the custom clone sequence may differ by one or more nucleotides
ATGGCGCCATCGCCCAGGACCGGCAGCCGGCAAGATGCGACCGCCCTGCCCAGCATGTCC
TCAACTTTCTGGGCGTTCATGATCCTGGCCAGCCTGCTCATCGCCTACTGCAGTCAGCTG
GCCGCCGGCACCTGTGAGATTGTGACCTTGGACCGGGACAGCAGCCAGCCTCGGAGGACG
ATCGCCCGGCAGACCGCCCGCTGTGCGTGTAGAAAGGGGCAGATCGCCGGCACCACGAGA
GCCCGGCCCGCCTGTGTGGACGCAAGAATCATCAAGACCAAGCAGTGGTGTGACATGCTT
CCGTGTCTGGAGGGGGAAGGCTGCGACTTGTTAATCAACCGGTCAGGCTGGACGTGCACG
CAGCCCGGCGGGAGGATAAAGACCACCACGGTCTCC
Restriction Sites Please inquire     
ACCN NM_001082967
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001082967.1, NP_001076436.1
RefSeq Size 2615 bp
RefSeq ORF 399 bp
Locus ID 25817
UniProt ID Q7Z5A7
Cytogenetics 22q13.32
Protein Families Secreted Protein, Transmembrane
Gene Summary This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines that act as regulators of immune and nervous cells. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (1) represents the shorter transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.