LILRB5 (NM_001081443) Human Untagged Clone

CAT#: SC315959

LILRB5 (untagged)-Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5 (LILRB5), transcript variant 3


  "NM_001081443" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


LILRB5 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "LILRB5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LILRB5
Synonyms CD85C; LIR-8; LIR8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001081443 edited
ATGACCCTCACCCTCTCAGTCCTGATTTGCCTCGGGCTGAGTGTGGGCCCCAGGACCTGC
GTGCAGGCAGGCACCCTCCCCAAACCCACCCTCTGGGCTGAGCCAGCCTCTGTGATAGCT
CGGGGGAAGCCCGTGACCCTCTGGTGTCAGGGGCCCCTGGAGACTGAGGAGTACCGTCTG
GATAAGGAGGGACTCCCATGGGCCCGGAAGAGACAGAACCCACTGGAGCCTGGAGCCAAG
GCCAAGTTCCACATTCCATCCACGGTGTATGACAGTGCAGGGCGATACCGCTGCTACTAT
GAGACCCCTGCAGGCTGGTCAGAGCCCAGTGACCCCCTGGAGCTGGTGGCGACAGGCGTG
TCTAGGAAGCCCTCCCTCCTGATCCCGCAGGGCTCTGTCGTGGCCCGCGGAGGCAGCCTG
ACCCTGCAGTGTCGCTCTGATGTCGGCTATGACATATTCGTTCTGTACAAGGAGGGGGAA
CATGACCTCGTCCAGGGCTCTGGCCAGCAGCCCCAGGCTGGGCTCTCCCAGGCCAACTTC
ACCCTGGGCCCTGTGAGCCGCTCCCACGGGGGCCAGTACAGATGCTACGGTGCACACAAC
CTCTCCCCTAGGTGGTCGGCCCCCAGCGACCCCCTGGACATCCTGATCGCAGGACTGATC
CCTGACATACCCGCCCTCTCGGTGCAGCCGGGCCCCAAGGTGGCCTCAGGAGAGAACGTG
ACCCTGCTGTGTCAGTCATGGCATCAGATAGACACTTTCTTTTTGACCAAGGAGGGGGCA
GCCCATCCCCCGCTGTGTCTAAAGTCAAAGTACCAGTCTTATAGACACCAGGCTGAATTC
TCCATGAGTCCTGTGACCTCAGCCCAGGGTGGAACCTACCGATGCTACAGCGCAATCAGG
TCCTACCCCTACCTGCTGTCCAGCCCTAGTTACCCCCAGGAGCTCGTGGTCTCAGGACCC
TCTGGGGATCCCAGCCTCTCACCTACAGGCTCCACCCCCACACCTGCAGGCCCTGAGGAC
CAGCCCCTCACCCCCACGGGGTTGGATCCCCAGAGTGGTCTGGGAAGGCACCTGGGGGTT
GTGACTGGGGTCTCAGTGGCCTTCGTCCTGCTGCTGTTCCTCCTCCTCTTCCTCCTCCTC
CGACATCGGCATCAGAGCAAACACAGGACATCGGCCCATTTCTACCGTCCTGCAGGGGCT
GCGGGGCCAGAGCCCAAGGACCAGGGCCTGCAGAAGAGGGCCAGCCCAGTTGCTGACATC
CAGGAGGAAATTCTCAATGCTGCCGTGAAGGACACACAGCCCAAGGACGGGGTGGAGATG
GATGCTCGGGCTGCTGCATCTGAAGCCCCCCAGGATGTGACCTACGCCCAGCTACACAGC
TTGACCCTCAGACGGGAGGCAACTGAGCCTCCTCCATCCCAGGAAAGGGAACCTCCAGCT
GAACCCAGCATCTACGCCCCCCTGGCCATCCACTAG
Restriction Sites Please inquire     
ACCN NM_001081443
Insert Size 1500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001081443.1, NP_001074912.1
RefSeq Size 1982 bp
RefSeq ORF 1476 bp
Locus ID 10990
UniProt ID O75023
Cytogenetics 19q13.42
Protein Families Transmembrane
Gene Summary This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). Several other LIR subfamily B receptors are expressed on immune cells where they bind to MHC class I molecules on antigen-presenting cells and inhibit stimulation of an immune response. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region compared to variant 1. The encoded isoform (3) is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.