Glutathione S Transferase theta 2 (GSTT2B) (NM_001080843) Human Untagged Clone

CAT#: SC315934

GSTT2B (untagged)-Human glutathione S-transferase theta 2B (gene/pseudogene) (GSTT2B)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Glutathione S Transferase theta 2
• Synonyms: GSTT2P
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC315934 representing NM_001080843.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGGCCTAGAGCTGTTTCTTGACCTGGTGTCCCAGCCCAGCCGCGCCGTCTACATCTTCGCCAAGAAG
  AATGGCATCCCCTTAGAGCTGCGCACCGTGGATTTGGTCAAAGGGCAGCACAAGAGCAAGGAGTTCTTG
  CAGATCAACAGCCTGGGGAAACTGCCGACGCTCAAGGATGGTGATTTCATCTTGACCGAAAGCTCGGCC
  ATCCTGATTTACCTGAGCTGTAAGTACCAGACGCCGGACCACTGGTATCCATCTGACCTGCAGGCTCGT
  GCCCGTGTTCATGAGTACCTGGGCTGGCATGCCGACTGCATCCGTGGCACCTTTGGTATACCCCTGTGG
  GTCCAGGTGTTGGGGCCACTCATTGGGGTCCAGGTGCCCGAGGAGAAGGTGGAACGCAACAGGACTGCC
  ATGGACCAGGCCCTGCAATGGCTGGAGGACAAGTTCCTGGGGGACAGGCCCTTCCTCGCTGGCCAGCAG
  GTGACACTGGCTGATCTCATGGCCCTGGAGGAGCTGATGCAGCCGGTGGCTCTCGGCTATGAACTGTTT
  GAGGGACGGCCACGACTGGCAGCATGGCGTGGACGAGTGGAGGCTTTCCTGGGTGCTGAGCTATGCCAG
  GAGGCCCACAGCATCATCTTGAGCATCCTGGAACAGGCGGCCAAGAAAACCCTCCCAACACCCTCACCA
  GAGGCCTATCAGGCTATGCTGCTTCGAATCGCCAGGATCCCCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001080843
• Insert Size: 735 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001080843.3
• RefSeq Size: 1108 bp
• RefSeq ORF: 735 bp
• Locus ID: 653689
• UniProt ID: P0CG30
• Cytogenetics: 22q11.23
• MW: 27.5 kDa
• Gene Summary: The protein encoded by this gene, glutathione S-transferase (GST) theta 2B (GSTT2B), is a member of a superfamily of proteins that catalyze the conjugation of reduced glutathione to a variety of electrophilic and hydrophobic compounds. Human GSTs can be divided into five main classes: alpha, mu, pi, theta, and zeta. The theta class includes GSTT1, GSTT2, and GSTT2B. GSTT2 and GSTT2B are nearly identical to each other, and share 55% amino acid identity with GSTT1. All three genes may play a role in human carcinogenesis. The GSTT2B gene is a pseudogene in some populations. [provided by RefSeq, Sep 2015]