MIER1 (NM_001077702) Human Untagged Clone

CAT#: SC315564

MIER1 (untagged)-Human mesoderm induction early response 1 homolog (Xenopus laevis) (MIER1), transcript variant 4


  "NM_001077702" in other vectors (4)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


MIER1 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "MIER1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MIER1
Synonyms ER1; MI-ER1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001077702, the custom clone sequence may differ by one or more nucleotides
ATGCTGAAAATGTGCATCAGATGTTTATGTTTAATTGGTTTACAGACTGTCTGTGGACTC
TTTTCCTGTCAAATTACCCAGCCATCTGTTGAATCTTCAAGTCCAGGAGGTTCAGCAACA
TCAGATGACCATGAATTTGATCCATCAGCTGACATGCTGGTTCATGATTTTGATGATGAA
CGAACATTAGAAGAGGAAGAAATGATGGAAGGAGAAACAAACTTCAGCTCTGAAATAGAA
GATCTTGCAAGGGAAGGCGACATGCCAATTCATGAACTTCTCAGCCTTTATGGTTATGGT
AGTACTGTTCGACTACCTGAAGAAGATGAGGAAGAGGAAGAAGAGGAAGAAGAAGGTGAA
GATGATGAAGATGCTGATAATGATGACAACAGTGGCTGTAGTGGGGAAAATAAAGAGGAG
AATATAAAGGATTCATCAGGTCAGGAGGATGAAACTCAGTCTTCCAATGATGATCCATCA
CAATCTGTTGCTTCTCAAGATGCCCAGGAAATAATCCGCCCACGTCGATGTAAATATTTT
GATACAAATAGTGAAGTAGAAGAAGAATCTGAAGAAGATGAAGATTATATTCCATCAGAA
GACTGGAAAAAGGAGATTATGGTGGGCTCCATGTTTCAAGCAGAAATTCCAGTTGGCATT
TGTAGATACAAAGAAAATGAAAAAGTATATGAAAATGATGATCAGCTCCTGTGGGACCCT
GAGTACTTACCAGAAGATAAAGTGATTATATTTCTTAAAGATGCATCTAGAAGAACAGGT
GATGAGAAGGGTGTAGAAGCAATTCCTGAAGGATCTCACATAAAAGACAATGAACAGGCT
TTATATGAATTGGTTAAATGCAATTTTGATACAGAAGAAGCATTGAGAAGATTAAGATTT
AATGTAAAAGCAGCTAGAGAGGAATTATCTGTTTGGACAGAGGAAGAGTGTAGAAATTTT
GAACAAGGGCTGAAGGCCTATGGAAAGGATTTTCATTTGATTCAGGCTAATAAAGTCCGA
ACAAGGTCAGTTGGTGAATGTGTAGCATTCTATTACATGTGGAAAAAATCTGAACGTTAT
GATTTCTTTGCTCAGCAAACACGATTTGGAAAGAAGAAATATAATCTTCATCCTGGTGTA
ACGGATTACATGGATCGTCTTCTAGACGAAAGTGAAAGTGCTGCATCTAGTCGAGCACCA
TCCCCTCCCCCAACTGCATCAAACAGTAGTAACAGCCAGTCTGAGAAAGAAGATGGCACT
GTAAGCACTGCTAATCAAAATGGAGTGTCATCTAATGGACCAGGCATACTCCAAATGCTT
CTTCCAGTTCATTTTTCAGCCATCAGTTCAAGAGCCAATGCCTTTTTAAAA
Restriction Sites Please inquire     
ACCN NM_001077702
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001077702.1, NP_001071170.1
RefSeq Size 1804 bp
RefSeq ORF 1374 bp
Locus ID 57708
UniProt ID Q8N108
Cytogenetics 1p31.3
Gene Summary This gene encodes a protein that was first identified in Xenopus laevis by its role in a mesoderm induction early response (MIER). The encoded protein functions as a transcriptional regulator. Alternatively spliced transcript variants encode multiple isoforms, some of which lack a C-terminal nuclear localization signal. [provided by RefSeq, May 2013]
Transcript Variant: This variant (4) lacks an alternate segment in the 3' coding region, compared to variant 1. The resulting isoform (d) has a shorter and distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.