OPCML (NM_002545) Human Untagged Clone

CAT#: SC313047

OPCML (untagged)-Human opioid binding protein/cell adhesion molecule-like (OPCML), transcript variant 1


  "NM_002545" in other vectors (4)

Reconstitution Protocol

USD 503.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Anti-OPCML Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "OPCML"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol OPCML
Synonyms IGLON1; OBCAM; OPCM
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC313047 representing NM_002545.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGGTCTGTGGGTACCTGTTCCTGCCCTGGAAGTGCCTCGTGGTCGTGTCTCTCAGGCTGCTGTTC
CTTGTACCCACAGGAGTGCCCGTGCGCAGCGGAGATGCCACCTTCCCCAAAGCTATGGACAACGTGACG
GTCCGGCAGGGGGAGAGCGCCACCCTCAGGTGTACCATAGATGACCGGGTAACCCGGGTGGCCTGGCTA
AACCGCAGCACCATCCTCTACGCTGGGAATGACAAGTGGTCCATAGACCCTCGTGTGATCATCCTGGTC
AATACACCAACCCAGTACAGCATCATGATCCAAAATGTGGATGTGTATGACGAAGGTCCGTACACCTGC
TCTGTGCAGACAGACAATCATCCCAAAACGTCCCGGGTTCACCTAATAGTGCAAGTTCCTCCTCAGATC
ATGAATATCTCCTCAGACATCACTGTGAATGAGGGAAGCAGTGTGACCCTGCTGTGTCTTGCTATTGGC
AGACCAGAGCCAACTGTGACATGGAGACACCTGTCAGTCAAGGAAGGCCAGGGCTTTGTAAGTGAGGAT
GAGTACCTGGAGATCTCTGACATCAAGCGAGACCAGTCCGGGGAGTACGAATGCAGCGCGTTGAACGAT
GTCGCTGCGCCCGATGTGCGGAAAGTAAAAATCACTGTAAACTATCCTCCCTATATCTCAAAAGCCAAG
AACACTGGTGTTTCAGTCGGTCAGAAGGGCATCCTGAGCTGTGAAGCCTCTGCAGTCCCCATGGCTGAA
TTCCAGTGGTTCAAGGAAGAAACCAGGTTAGCCACTGGTCTGGATGGAATGAGGATTGAAAACAAAGGC
CGCATGTCCACTCTGACTTTCTTCAATGTTTCAGAAAAGGATTATGGGAACTATACTTGTGTGGCCACG
AACAAGCTTGGGAACACCAATGCCAGCATCACATTGTATGGGCCTGGAGCAGTCATTGATGGTGTAAAC
TCGGCCTCCAGAGCACTGGCTTGTCTCTGGCTATCAGGGACCCTCTTAGCCCACTTCTTCATCAAGTTT
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_002545
Insert Size 1038 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002545.4
RefSeq Size 7111 bp
RefSeq ORF 1038 bp
Locus ID 4978
UniProt ID Q14982
Cytogenetics 11q25
Domains ig, IGc2, IG
Protein Families Druggable Genome, Transmembrane
MW 38 kDa
Gene Summary This gene encodes a member of the IgLON subfamily in the immunoglobulin protein superfamily of proteins. The encoded preprotein is proteolytically processed to generate the mature protein. This protein is localized in the plasma membrane and may have an accessory role in opioid receptor function. This gene has an ortholog in rat and bovine. The opioid binding-cell adhesion molecule encoded by the rat gene binds opioid alkaloids in the presence of acidic lipids, exhibits selectivity for mu ligands and acts as a GPI-anchored protein. Since the encoded protein is highly conserved in species during evolution, it may have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (1) lacks an alternate in-frame exon in the 3' coding region compared to variant 3. The encoded isoform (a) is shorter than isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.