PYCR1 (NM_153824) Human Untagged Clone

CAT#: SC312931

PYCR1 (untagged)-Human pyrroline-5-carboxylate reductase 1 (PYCR1), transcript variant 2


  "NM_153824" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
PYCR1 mouse monoclonal antibody,clone OTI4F2
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PYCR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PYCR1
Synonyms ARCL2B; ARCL3B; P5C; P5CR; PIG45; PP222; PRO3; PYCR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312931 representing NM_153824.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCGTGGGCTTCATCGGCGCTGGCCAGCTGGCTTTTGCCCTGGCCAAGGGCTTCACAGCAGCAGGC
GTCTTGGCTGCCCACAAGATAATGGCTAGCTCCCCAGACATGGACCTGGCCACAGTTTCTGCTCTCAGG
AAGATGGGGGTGAAGTTGACACCCCACAACAAGGAGACGGTGCAGCACAGTGATGTGCTCTTCCTGGCT
GTGAAGCCACACATCATCCCCTTCATCCTGGATGAAATAGGCGCCGACATTGAGGACAGACACATTGTG
GTGTCCTGCGCGGCCGGCGTCACCATCAGCTCCATTGAGAAGAAGCTGTCAGCGTTTCGGCCAGCCCCC
AGGGTCATCCGCTGCATGACCAACACTCCAGTCGTGGTGCGGGAGGGGGCCACCGTGTATGCCACAGGC
ACGCACGCCCAGGTGGAGGACGGGAGGCTCATGGAGCAGCTGCTGAGCAGCGTGGGCTTCTGCACGGAG
GTGGAAGAGGACCTGATTGATGCCGTCACGGGGCTCAGTGGCAGCGGCCCCGCCTACGCATTCACAGCC
CTGGATGCCCTGGCTGATGGGGGTGTGAAGATGGGACTTCCAAGGCGCCTGGCAGTCCGCCTCGGGGCC
CAGGCCCTCCTGGGGGCTGCCAAGATGCTGCTGCACTCAGAACAGCACCCAGGCCAGCTCAAGGACAAC
GTCAGCTCTCCTGGTGGGGCCACCATCCATGCCTTGCATGTGCTGGAGAGTGGGGGCTTCCGCTCCCTG
CTCATCAACGCTGTGGAGGCCTCCTGCATCCGCACACGGGAGCTGCAGTCCATGGCTGACCAGGAGCAG
GTGTCACCAGCCGCCATCAAGAAGACCATCCTGGACAAGGACCACCTTCCTCTAGAGCTCGGGAGCCCG
GAGGGTCTTCACCCACTCCTACTCCAGTATCAGCTGGCACGGGCTCCTTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_153824
Insert Size 951 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_153824.2
RefSeq Size 1890 bp
RefSeq ORF 951 bp
Locus ID 5831
UniProt ID P32322
Cytogenetics 17q25.3
Domains P5CR
Protein Pathways Arginine and proline metabolism, Metabolic pathways
MW 33.3 kDa
Gene Summary This gene encodes an enzyme that catalyzes the NAD(P)H-dependent conversion of pyrroline-5-carboxylate to proline. This enzyme may also play a physiologic role in the generation of NADP(+) in some cell types. The protein forms a homopolymer and localizes to the mitochondrion. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (2) has multiple differences, compared to variant 5. These differences result in a distinct 5' UTR and cause translation initiation at a downstream start codon, compared to variant 5. The encoded isoform (2) is shorter than isoform 5.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.