ARL6IP4 (NM_018694) Human Untagged Clone

CAT#: SC310501

ARL6IP4 (untagged)-Human ADP-ribosylation-like factor 6 interacting protein 4 (ARL6IP4), transcript variant 1


  "NM_018694" in other vectors (4)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit Polyclonal Anti-ARL6IP4 Antibody
    • 100 ul

USD 539.00

Other products for "ARL6IP4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ARL6IP4
Synonyms SFRS20; SR-25; SRp25; SRrp37
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_018694, the custom clone sequence may differ by one or more nucleotides
ATGGAGAGGGCAGGACCAGCCGGGGAGGAGGGCGGCGCGCGCGAGGGTCGCCTTCTTCCC
AGGGCACCGGGGGCGTGGGTGCTGCGGGCGTGCGCCGAGAGGGCAGCCTTGGAAGTGGGC
GCAGCTTCGGCAGACACAGGCGTGAGGGGCTGCGGAGCTCGAGGGCCGGCGCCCCTGCTT
GCCTCTGCGGGAGGTGGGCGCGCCCGGGACGGAACCTGGGGCGTCAGAACGAAAGGCAGC
GGCGCCGCGCTTCCCAGCCGGCCAGCCTCCCGCGCAGCGCCCCGGCCGGAAGCCTCCTCG
CCGCCGCTTCCTCTCGAGAAGGCGCGGGGCGGGCTGTCCGGCCCGCAGGGCGGTCGAGCC
CGCGGCGCCATGGCTCACGTCGGCTCCCGCAAGCGCTCGAGGAGTCGCAGCCGGTCCCGG
GGACGGGGGTCGGAAAAGAGAAAGAAGAAGAGCAGGAAAGACACCTCGAGGAACTGCTCG
GCCTCCACATCCCAAGGTCGCAAGGCCAGCACGGCCCCTGGGGCGGAGGCCTCACCTTCT
CCCTGCATCACAGAGAGAAGCAAGCAGAAGGCCCGGAGGAGAACAAGATCCAGCTCCTCC
TCCTCTTCTTCCAGTTCTTCTAGCTCCTCTTCTTCCTCCTCGTCCTCCTCCTCTTCCTCC
AGTGATGGCCGGAAGAAGCGGGGGAAGTACAAGGACAAGAGGAGGAAGAAGAAGAAGAAG
AGGAAGAAGCTGAAGAAGAAGGGCAAGGAGAAGGCGGAAGCACAGCAGGTGGAGGCTCTG
CCGGGCCCCTCGCTGGACCAGTGGCACCGATCAGCTGGGGAGGAAGAGGATGGCCCAGTC
CTGACGGATGAGCAGAAGTCCCGAATCCAGGCCATGAAGCCCATGACCAAGGAGGAGTGG
GATGCCCGGCAGAGCATCATCCGCAAGGTGGTGGACCCTGAGACGGGGCGCACCAGGCTT
ATTAAGGGAGATGGCGAGGTCCTAGAGGAAATCGTAACCAAAGAACGACACAGAGAGATC
AACAAGCAAGCCACCCGAGGGGACTGCCTGGCCTTCCAGATGCGAGCTGGGTTGCTTCCC
TGA
Restriction Sites Please inquire     
ACCN NM_018694
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_018694.2, NP_061164.2
RefSeq Size 1378 bp
RefSeq ORF 1083 bp
Locus ID 51329
UniProt ID Q66PJ3
Cytogenetics 12q24.31
Gene Summary Involved in modulating alternative pre-mRNA splicing with either 5' distal site activation or preferential use of 3' proximal site. In case of infection by Herpes simplex virus (HSVI), may act as a splicing inhibitor of HSVI pre-mRNA.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.