WARS2 (NM_015836) Human Untagged Clone

CAT#: SC310498

WARS2 (untagged)-Human tryptophanyl tRNA synthetase 2, mitochondrial (WARS2), nuclear gene encoding mitochondrial protein, transcript variant 1


  "NM_015836" in other vectors (6)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


WARS2 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "WARS2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol WARS2
Synonyms mtTrpRS; NEMMLAS; TrpRS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310498 representing NM_015836.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCTGCACTCAATGCGGAAAGCGCGTGAGCGCTGGAGCTTCATCCGGGCACTTCATAAGGGATCC
GCAGCTGCTCCCGCTCTCCAGAAAGACAGCAAGAAGCGAGTATTTTCCGGCATTCAACCTACAGGAATC
CTCCACCTGGGCAATTACCTGGGAGCCATTGAGAGCTGGGTGAGGTTACAGGATGAATATGACTCTGTA
TTATACAGCATTGTTGACCTCCACTCCATTACTGTCCCCCAAGACCCAGCTGTCCTTCGGCAGAGCATC
CTGGACATGACTGCTGTTCTTCTTGCCTGTGGCATAAACCCGGAAAAAAGCATCCTTTTCCAACAATCT
CAGGTGTCTGAACACACACAATTAAGTTGGATCCTTTCCTGCATGGTCAGACTACCTCGATTACAACAT
TTACATCAGTGGAAGGCAAAGACTACCAAGCAGAAGCACGATGGCACGGTGGGCCTGCTCACATACCCA
GTACTCCAGGCAGCCGACATTCTGTTGTACAAGTCCACACACGTTCCTGTTGGGGAGGATCAAGTCCAG
CACATGGAACTAGTTCAGGATCTAGCACAAGGTTTCAACAAGAAGTATGGGGAGTTCTTTCCAGTGCCC
GAGTCCATTCTCACATCCATGAAGAAGGTAAAATCCCTACGTGATCCTTCTGCCAAAATGTCGAAATCA
GACCCTGACAAACTGGCCACCGTCCGAATAACAGACAGCCCAGAGGAGATAGTGCAGAAATTCCGCAAG
GCTGTGACAGACTTCACCTCGGAGGTCACCTATGACCCGGCTGGCCGCGCTGGCGTGTCCAACATAGTG
GCGGTGCATGCCGCGGTGACGGGGCTCTCCGTGGAGGAAGTGGTGCGCCGCAGCGCGGGCATGAACACT
GCTCGCTACAAGCTGGCCGTGGCAGATGCTGTGATTGAGAAGTTTGCCCCAATTAAGCGTGAAATTGAA
AAACTGAAGCTGGACAAGGACCATTTAGAGAAGGTTTTACAAATTGGATCAGCAAAAGCCAAAGAATTA
GCATACACTGTGTGCCAGGAGGTGAAGAAATTGGTGGGTTTTCTATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_015836
Insert Size 1083 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_015836.3
RefSeq Size 2806 bp
RefSeq ORF 1083 bp
Locus ID 10352
UniProt ID Q9UGM6
Cytogenetics 1p12
Domains tRNA-synt_1b
Protein Families Druggable Genome
Protein Pathways Aminoacyl-tRNA biosynthesis, Tryptophan metabolism
MW 40.1 kDa
Gene Summary Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of tryptophanyl-tRNA synthetase exist, a cytoplasmic form, named WARS, and a mitochondrial form, named WARS2. This gene encodes the mitochondrial tryptophanyl-tRNA synthetase. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the shorter transcript but encodes the longer protein (isoform 1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.