MPZL3 (NM_198275) Human Untagged Clone

CAT#: SC309361

MPZL3 (untagged)-Human myelin protein zero-like 3 (MPZL3)


  "NM_198275" in other vectors (6)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
MPZL3 Antibody - C-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "MPZL3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MPZL3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC309361 representing NM_198275.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGCAGAGAGGAGCAGCTGGAAGCCGTGGCTGCGCTCTCTTCCCTCTGCTGGGCGTCCTGTTCTTC
CAGGGTGTTTATATCGTCTTTTCCTTGGAGATTCGTGCAGATGCCCATGTCCGAGGTTATGTTGGAGAA
AAGATCAAGTTGAAATGCACTTTCAAGTCAACTTCAGATGTCACTGACAAACTTACTATAGACTGGACA
TATCGCCCTCCCAGCAGCAGCCACACAGTATCAATATTTCATTATCAGTCTTTCCAGTACCCAACCACA
GCAGGCACATTTCGGGATCGGATTTCCTGGGTTGGAAATGTATACAAAGGGGATGCATCTATAAGTATA
AGCAACCCTACCATAAAGGACAATGGGACATTCAGCTGTGCTGTGAAGAATCCCCCAGATGTGCATCAT
AATATTCCCATGACAGAGCTAACAGTCACAGAAAGGGGTTTTGGCACCATGCTTTCCTCTGTGGCCCTT
CTTTCCATCCTTGTCTTTGTGCCCTCAGCCGTGGTGGTTGCTCTGCTGCTGGTGAGAATGGGGAGGAAG
GCTGCTGGGCTGAAGAAGAGGAGCAGGTCTGGCTATAAGAAGTCATCTATTGAGGTTTCCGATGACACT
GATCAGGAGGAGGAAGAGGCGTGTATGGCGAGGCTTTGTGTCCGTTGCGCTGAGTGCCTGGATTCAGAC
TATGAAGAGACATATTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_198275
Insert Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_198275.2
RefSeq Size 3986 bp
RefSeq ORF 708 bp
Locus ID 196264
UniProt ID Q6UWV2
Cytogenetics 11q23.3
Protein Families Transmembrane
MW 26 kDa
Gene Summary Mediates homophilic cell-cell adhesion.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.