BNIP1 (NM_013979) Human Untagged Clone
CAT#: SC308932
BNIP1 (untagged)-Human BCL2/adenovirus E1B 19kDa interacting protein 1 (BNIP1), transcript variant BNIP1-b
"NM_013979" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BNIP1 |
Synonyms | NIP1; SEC20; TRG-8 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC308932 representing NM_013979.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCTCCCCAAGACGTCCACGTCCGGATCTGTAACCAAGAGATTGTCAAATTTGACCTGGAGGTG AAGGCGCTTATTCAGGATATCCGTGATTGTTCAGGACCCTTAAGTGCTCTTACTGAACTGAATACTAAA GTAAAAGAGAAATTTCAACAGTTGCGTCACAGAATACAGCCAGTTCTCTATCAAAGGGCATTTATTTGG ACTGCTTCCACATTTTTTTTTAAGCTAACTTATTCCCTGACAGACTTTTCTTCAACTCAGCATGACTTC AACTCTCCAACTACACCTGTTACCTTCAGTGACCTGGAGCAGTTGGCTAAAGAGCAAGACAAAGAATCA GAGAAACAACTTCTACTCCAGGAAGTGGAGAATCACAAAAAGCAGATGCTCAGCAATCAGGCCTCATGG AGGAAAGCTAATCTCACCTGCAAAATTGCAATCGACAATCTAGAGAAAGCAGAACTTCTTCAGGGAGGA GATCTCTTAAGGCAAAGGAAAACCACCAAAGAGAGCCTGGCCCAGACATCCAGTACCATCACTGAGAGC CTCATGGGGATCAGCAGGATGATGGCCCAGCAGGTCCAGCAGAGCGAGGAGGCCATGCAGTCTCTAGTC ACTTCTTCACGAACGATCCTGGATGCAAATGAAGAATTTAAGTCCATGTCGGGCACCATCCAGCTGGGC CGGAAGCTTATCACAAAATACAATCGCCGGGAGCTGACGGACAAGCTTCTCATCTTCCTTGCGCTAGCC CTGTTTCTTGCTACGGTCCTCTATATTGTGAAAAAGCGGCTCTTTCCATTTTTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_013979 |
Insert Size | 816 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_013979.2 |
RefSeq Size | 1388 bp |
RefSeq ORF | 816 bp |
Locus ID | 662 |
UniProt ID | Q12981 |
Cytogenetics | 5q35.1 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | SNARE interactions in vesicular transport |
MW | 31.1 kDa |
Gene Summary | This gene is a member of the BCL2/adenovirus E1B 19 kd-interacting protein (BNIP) family. It interacts with the E1B 19 kDa protein, which protects cells from virally-induced cell death. The encoded protein also interacts with E1B 19 kDa-like sequences of BCL2, another apoptotic protector. In addition, this protein is involved in vesicle transport into the endoplasmic reticulum. Alternative splicing of this gene results in four protein products with identical N- and C-termini. [provided by RefSeq, Mar 2011] Transcript Variant: Transcript variant BNIP1-b contains a 129-nucleotide in-frame insertion relative to the full-length BNIP1 variant. This variant contains a fully conserved BH3 domain which has been associated with pro-apoptotic function. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224830 | BNIP1 (Myc-DDK-tagged)-Human BCL2/adenovirus E1B 19kDa interacting protein 1 (BNIP1), transcript variant BNIP1-b |
USD 300.00 |
|
RC224830L3 | Lenti ORF clone of Human BCL2/adenovirus E1B 19kDa interacting protein 1 (BNIP1), transcript variant BNIP1-b, Myc-DDK-tagged |
USD 600.00 |
|
RC224830L4 | Lenti ORF clone of Human BCL2/adenovirus E1B 19kDa interacting protein 1 (BNIP1), transcript variant BNIP1-b, mGFP tagged |
USD 600.00 |
|
RG224830 | BNIP1 (tGFP-tagged) - Human BCL2/adenovirus E1B 19kDa interacting protein 1 (BNIP1), transcript variant BNIP1-b |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review