Nebulette (NEBL) (NM_213569) Human Untagged Clone

CAT#: SC308659

NEBL (untagged)-Human nebulette (NEBL), transcript variant 2


  "NM_213569" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Nebulette"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Nebulette
Synonyms bA165O3.1; C10orf113; LASP2; LNEBL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308659 representing NM_213569.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACCCCCAGTGCGCCCGTTGCGGAAAAGTCGTGTATCCCACCGAGAAAGTCAACTGCCTGGATAAG
TATTGGCATAAAGGATGTTTCCATTGTGAGGTCTGCAAGATGGCACTCAACATGAACAACTACAAAGGC
TATGAAAAGAAGCCCTATTGTAATGCACACTACCCGAAGCAGTCCTTCACCACGGTGGCAGATACACCT
GAAAATCTTCGCCTGAAGCAGCAAAGTGAATTGCAGAGTCAGGTCAAGTACAAAAGAGATTTTGAAGAA
AGCAAAGGGAGGGGCTTCAGCATCGTCACGGACACTCCTGAGCTACAGAGACTGAAGAGGACTCAGGAG
CAAATCAGTAATGTAAAATACCATGAAGATTTTGAAAAAACAAAGGGGAGAGGCTTTACTCCCGTCGTG
GACGATCCTGTGACAGAGAGAGTGAGGAAGAACACCCAGGTGGTCAGCGATGCTGCCTATAAAGGGGTC
CACCCTCACATCGTGGAGATGGACAGGAGACCTGGAATCATTGTTGCACCTGTTCTTCCCGGAGCCTAT
CAGCAAAGCCATTCCCAAGGCTATGGCTACATGCACCAGACCAGTGTGTCATCCATGAGATCAATGCAG
CATTCACCAAATCTAAGGACCTACCGAGCCATGTACGATTACAGTGCCCAGGATGAAGACGAGGTCTCC
TTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACGGCACAGTGCAG
AGAACAGGGAGAACAGGAATGCTCCCAGCGAATTACATTGAGTTTGTTAATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_213569
Insert Size 813 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_213569.2
RefSeq Size 6956 bp
RefSeq ORF 813 bp
Locus ID 10529
UniProt ID O76041
Cytogenetics 10p12.31
MW 31.2 kDa
Gene Summary This gene encodes a nebulin like protein that is abundantly expressed in cardiac muscle. The encoded protein binds actin and interacts with thin filaments and Z-line associated proteins in striated muscle. This protein may be involved in cardiac myofibril assembly. A shorter isoform of this protein termed LIM nebulette is expressed in non-muscle cells and may function as a component of focal adhesion complexes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Transcript Variant: This variant (2) has multiple differences, compared to variant 1. These differences result in a distinct 5' UTR and cause translation initiation at an alternate start codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct N-terminus compared to isoform 1. This isoform is referred to as LIM-nebulette or the non-muscle isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.