GFRAL (NM_207410) Human Untagged Clone

CAT#: SC308523

GFRAL (untagged)-Human GDNF family receptor alpha like (GFRAL)


  "NM_207410" in other vectors (6)

Reconstitution Protocol

USD 732.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Rabbit Polyclonal Anti-GFRAL Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "GFRAL"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GFRAL
Synonyms bA360D14.1; C6orf144; GRAL; UNQ9356
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_207410, the custom clone sequence may differ by one or more nucleotides
ATGATAGTGTTTATTTTCTTGGCTATGGGGTTAAGCTTGGAAAATGAATACACTTCCCAA
ACCAATAATTGCACATATTTAAGAGAGCAATGCTTACGTGATGCAAATGGATGTAAACAT
GCTTGGAGAGTAATGGAAGATGCCTGCAATGATTCAGATCCAGGTGACCCCTGCAAGATG
AGGAATTCATCATACTGTAACCTGAGTATCCAGTACTTAGTGGAAAGCAATTTCCAATTT
AAAGAGTGTCTTTGCACTGATGACTTCTATTGTACTGTGAACAAACTGCTTGGAAAAAAA
TGTATCAATAAATCAGATAACGTGAAAGAGGATAAATTCAAATGGAATCTAACTACACGT
TCCCATCATGGATTCAAAGGGATGTGGTCCTGTTTGGAAGTGGCAGAGGCATGTGTAGGG
GATGTGGTCTGTAATGCACAGTTGGCCTCTTACCTTAAAGCTTGCTCAGCAAATGGAAAT
CCGTGTGATCTGAAACAGTGCCAAGCAGCCATACGGTTCTTCTATCAAAATATACCTTTT
AACATTGCCCAGATGTTGGCTTTTTGTGACTGTGCTCAATCTGATATACCTTGTCAGCAG
TCCAAAGAAGCTCTTCACAGCAAGACATGTGCAGTGAACATGGTTCCACCCCCTACTTGC
CTCAGTGTAATTCGCAGCTGCCAAAATGATGAATTATGCAGGAGGCACTATAGAACATTT
CAGTCAAAATGCTGGCAGCGTGTGACTAGAAAGTGCCATGAAGATGAGAATTGCATTAGC
ACCTTAAGCAAACAGGACCTCACTTGTTCAGGAAGTGATGACTGCAAAGCTGCTTACATA
GATATCCTTGGGACGGTCCTTCAAGTGCAATGTACCTGTAGGACCATTACACAAAGTGAG
GAATCTTTGTGTAAGATTTTCCAGCACATGCTTCATAGAAAATCATGTTTCAATTATCCA
ACCCTGTCTAATGTCAAAGGCATGGCATTGTATACAAGAAAACATGCAAACAAAATCACT
TTAACTGGATTTCATTCCCCCTTCAATGGAGAAGTAATCTATGCTGCCATGTGCATGACA
GTCACCTGTGGAATCCTTCTGTTGGTTATGGTCAAGCTTAGAACTTCCAGAATATCAAGT
AAAGCAAGAGATCCTTCATCGATCCAAATACCTGGAGAACTCTGA
Restriction Sites Please inquire     
ACCN NM_207410
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_207410.1, NP_997293.1
RefSeq Size 1910 bp
RefSeq ORF 1185 bp
Locus ID 389400
UniProt ID Q6UXV0
Cytogenetics 6p12.1
Protein Families Druggable Genome, Transmembrane
Gene Summary Brainstem-restricted receptor for GDF15 which regulates food intake, energy expenditure and body weight in response to metabolic and toxin-induced stresses (PubMed:28953886, PubMed:28846097, PubMed:28846098, PubMed:28846099). Upon interaction with its ligand, GDF15, interacts with RET and induces cellular signaling through activation of MAPK- and AKT- signaling pathways.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.