TUBA3E (NM_207312) Human Untagged Clone

CAT#: SC308438

TUBA3E (untagged)-Human tubulin, alpha 3e (TUBA3E)


  "NM_207312" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Anti-TUBA3E (Tubulin alpha 3e) mouse monoclonal antibody, clone OTI2A8 (formerly 2A8)
    • 100 ul

USD 447.00

Other products for "TUBA3E"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TUBA3E
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308438 representing NM_207312.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGCGAGTGTATCTCTATCCACGTGGGGCAGGCGGGTGTCCAGATCGGCAATGCCTGCTGGGAACTG
TACTGCCTTGAACATGGAATTCAGCCCGATGGTCAAATGCCAAGTGATAAAACCATTGGTGGCGGGGAC
GACTCCTTCAACACGTTCTTCAGTGAGACTGGAGCTGGCAAGCACGTGCCCAGAGCAGTGTTTGTGGAC
CTGGAGCCCACTGTGGTCGATGAAGTGCGCACAGGGACCTACAGGCAGCTCTTCCACCCAGAGCAGCTG
ATCACCGGGAAGGAAGATGCAGCCAGTAATTACGCCAGGGGCCATTACACCATCGGCAAGGAGATTGTT
GACCTAGTCCTGGACCGGATCCGCAAACTGGCGGATCTGTGCACAGGACTGCAGGGCTTCCTCATCTTC
CACAGCTTTGGGGGCGGCACTGGCTCTGGGTTCGCATCTCTGCTCATGGAGCGGCTCTCAGTGGATTAC
AGCAAGAAGTCCAAGCTAGAGTTTGCCATTTACCCAGCCCCCCAGGTCTCCACAGCCGTGGTGGAGCCC
TACAACTCCATCCTAACCACCCACACGACCCTGGAACATTCTGACTGTGCCTTCATGGTCGACAATGAA
GCCATCTATGACATATGTCGGCGCAACCTGGACATTGAACGTCCCACGTACACCAACCTCAATCGCCTG
ATTGGGCAGATCGTGTCCTCCATCACGGCCTCCCTGCGATTTGATGGGGCCCTGAATGTGGACTTGACG
GAATTCCAGACCAACCTCGTGCCGTACCCCCGCATCCACTTCCCCCTGGCCACCTACGCCCCAGTCATC
TCAGCTGAGAAGGCCTACCACGAGCAGCTGTCTGTGGCCGAGATCACCAATGCCTGCTTCGAGCCAGCC
AATCAGATGGTCAAGTGTGACCCTCGCCATGGCAAGTACATGGCCTGCTGCATGTTGTACAGGGGGGAC
GTGGTCCCCAAAGACGTCAATGCGGCCATCGCCACCATCAAGACCAAGCGCACTATCCAGTTTGTGGAT
TGGTGCCCGACTGGATTTAAGGTGGGCATTAACTACCAGCCCCCCACAGTGGTCCCCGGGGGAGACCTG
GCCAAGGTGCAGCGGGCCGTGTGCATGCTGAGCAACACCACGGCCATTGCGGAGGCCTGGGCCCGCCTG
GTCCATAAGTTCGATCTCATGTATGCCAAGTGGGCCTTTGTGCACTGGTACGTGGGCGAAGGCATGGAA
GAGGGAGAGTTCTCTGAGGCCCGCGAGGACCTGGCAGCTCTAGAGAAGGATTGTGAAGAGGTGGGCGTG
GATTCCGTGGAAGCTGAGGCTGAAGAAGGCGAAGAATACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_207312
Insert Size 1353 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_207312.2
RefSeq Size 1554 bp
RefSeq ORF 1353 bp
Locus ID 112714
UniProt ID Q6PEY2
Cytogenetics 2q21.1
Protein Families Druggable Genome
Protein Pathways Gap junction, Pathogenic Escherichia coli infection
MW 49.9 kDa
Gene Summary Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The genes encoding these microtubule constituents are part of the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. This gene encodes an alpha tubulin that highly conserved among species. A missense mutation in this gene has been potentially linked to microlissencephaly and global developmental delay. [provided by RefSeq, Jul 2016]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.