CA12 (NM_206925) Human Untagged Clone
CAT#: SC308325
CA12 (untagged)-Human carbonic anhydrase XII (CA12), transcript variant 2
"NM_206925" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CA12 |
Synonyms | CA-XII; CAXII; HsT18816; T18816 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC308325 representing NM_206925.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCCCGGCGCAGCCTGCACGCGGCGGCCGTGCTCCTGCTGGTGATCTTAAAGGAACAGCCTTCCAGC CCGGCCCCAGTGAACGGTTCCAAGTGGACTTATTTTGGTCCTGATGGGGAGAATAGCTGGTCCAAGAAG TACCCGTCGTGTGGGGGCCTGCTGCAGTCCCCCATAGACCTGCACAGTGACATCCTCCAGTATGACGCC AGCCTCACGCCCCTCGAGTTCCAAGGCTACAATCTGTCTGCCAACAAGCAGTTTCTCCTGACCAACAAT GGCCATTCAGTGAAGCTGAACCTGCCCTCGGACATGCACATCCAGGGCCTCCAGTCTCGCTACAGTGCC ACGCAGCTGCACCTGCACTGGGGGAACCCGAATGACCCGCACGGCTCTGAGCACACCGTCAGCGGACAG CACTTCGCCGCCGAGCTGCACATTGTCCATTATAACTCAGACCTTTATCCTGACGCCAGCACTGCCAGC AACAAGTCAGAAGGCCTCGCTGTCCTGGCTGTTCTCATTGAGATGGGCTCCTTCAATCCGTCCTATGAC AAGATCTTCAGTCACCTTCAACATGTAAAGTACAAAGGCCAGGAAGCATTCGTCCCGGGATTCAACATT GAAGAGCTGCTTCCGGAGAGGACCGCTGAATATTACCGCTACCGGGGGTCCCTGACCACACCCCCTTGC AACCCCACTGTGCTCTGGACAGTTTTCCGAAACCCCGTGCAAATTTCCCAGGAGCAGCTGCTGGCTTTG GAGACAGCCCTGTACTGCACACACATGGACGACCCTTCCCCCAGAGAAATGATCAACAACTTCCGGCAG GTCCAGAAGTTCGATGAGAGGCTGGTATACACCTCCTTCTCCCAAGGCATCATCCTCTCACTGGCCCTG GCTGGCATTCTTGGCATCTGTATTGTGGTGGTGGTGTCCATTTGGCTTTTCAGAAGGAAGAGTATCAAA AAAGGTGATAACAAGGGAGTCATTTACAAGCCAGCCACCAAGATGGAGACTGAGGCCCACGCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_206925 |
Insert Size | 1032 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_206925.2 |
RefSeq Size | 4176 bp |
RefSeq ORF | 1032 bp |
Locus ID | 771 |
UniProt ID | O43570 |
Cytogenetics | 15q22.2 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Nitrogen metabolism |
MW | 38.4 kDa |
Gene Summary | Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. This gene product is a type I membrane protein that is highly expressed in normal tissues, such as kidney, colon and pancreas, and has been found to be overexpressed in 10% of clear cell renal carcinomas. Three transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2014] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204034 | CA12 (Myc-DDK-tagged)-Human carbonic anhydrase XII (CA12), transcript variant 2 |
USD 457.00 |
|
RC204034L3 | Lenti ORF clone of Human carbonic anhydrase XII (CA12), transcript variant 2, Myc-DDK-tagged |
USD 757.00 |
|
RC204034L4 | Lenti ORF clone of Human carbonic anhydrase XII (CA12), transcript variant 2, mGFP tagged |
USD 757.00 |
|
RG204034 | CA12 (tGFP-tagged) - Human carbonic anhydrase XII (CA12), transcript variant 2 |
USD 657.00 |
|
SC321154 | CA12 (untagged)-Human carbonic anhydrase XII (CA12), transcript variant 2 |
USD 457.00 |
{0} Product Review(s)
Be the first one to submit a review