PIFO (NM_181643) Human Untagged Clone

CAT#: SC307336

PIFO (untagged)-Human chromosome 1 open reading frame 88 (C1orf88)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PIFO
• Synonyms: C1orf88; pitchfork
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_181643 edited
  GGCTCCGCAGCTGGGAATCACGGGACTAGCCTTCGTTTCCTTGGCAACGCAGTACACAAG
  TGCTAGCCCTAGCAGCTCGCGATGTGCTTCAGCAGAGCAGACGCTGCGGATAACTACCCT
  TTTGGAACATGTCAACAGAGGAAACTTTTTCCTCACTTCCATCCCCCGAATTTGATTGGG
  AACAAGTTTGTCCCTCTTAGGGGATCACCCCACAGAGGGCCTGGGTGTTATTTTTCAGAT
  GGATATGGCTTGGCATACGACTTATCTAAGATCCCAACCAGTATAAAAGGATATACTTTG
  GGAGCCAGAACAGCTGTGAGGTTTAAGCCAATACAGAAGGAAATGACACCTCATGCAGGC
  AGGTACCAGAAAGTAAGTCCTCAGCAGGAAAAACACAAACAAAATTTTGCTCCATTTAAT
  GTCTTGGTGCCTCGATTTAAGAACTACCCAAAGGACACTTACTATCCCAGCCCTGGTGCA
  TACAACCCAGAGAAGAAGCCACCGCCAAAAATTGCCTGGCCAATGAAATTTGGATCTCCA
  GACTGGGCTCAGGTTCCATGTCTACAGAAAAGAACCCTAAAAGCTGAGCTGTCCACAGAC
  AAAGACTTTAGAAAGCATCGGAACCGTGTGGCCTACCTAAGCCTGTATTATAATTGAGCG
  GCTGTAACTACCTTCACGTGCTCCTCTTATACACAGACTCTCCAGGACTGAGGACAGAGC
  TGC
  
• Restriction Sites: Please inquire
• ACCN: NM_181643
• Insert Size: 700 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_181643.2.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_181643.2, NP_857594.1
• RefSeq Size: 2343 bp
• RefSeq ORF: 576 bp
• Locus ID: 128344
• UniProt ID: Q8TCI5
• Cytogenetics: 1p13.2
• Gene Summary: During primary cilia disassembly, involved in cilia disassembly. Required specifically to control cilia retraction as well as the liberation and duplication of the basal body/centrosome. May act by stimulating AURKA activity at the basal body in a cell cycle-dependent manner.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1).