HNF 4 alpha (HNF4A) (NM_178850) Human Untagged Clone
CAT#: SC307233
HNF4A (untagged)-Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 3
"NM_178850" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HNF 4 alpha |
Synonyms | FRTS4; HNF4; HNF4a7; HNF4a8; HNF4a9; HNF4alpha; MODY; MODY1; NR2A1; NR2A21; TCF; TCF-14; TCF14 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_178850 edited
ATGCGACTCTCCAAAACCCTCGTCGACATGGACATGGCCGACTACAGTGCTGCACTGGAC CCAGCCTACACCACCCTGGAATTTGAGAATGTGCAGGTGTTGACGATGGGCAATGACACG TCCCCATCAGAAGGCACCAACCTCAACGCGCCCAACAGCCTGGGTGTCAGCGCCCTGTGT GCCATCTGCGGGGACCGGGCCACGGGCAAACACTACGGTGCCTCGAGCTGTGACGGCTGC AAGGGCTTCTTCCGGAGGAGCGTGCGGAAGAACCACATGTACTCCTGCAGATTTAGCCGG CAGTGCGTGGTGGACAAAGACAAGAGGAACCAGTGCCGCTACTGCAGGCTCAAGAAATGC TTCCGGGCTGGCATGAAGAAGGAAGCCGTCCAGAATGAGCGGGACCGGATCAGCACTCGA AGGTCAAGCTATGAGGACAGCAGCCTGCCCTCCATCAATGCGCTCCTGCAGGCGGAGGTC CTGTCCCGACAGATCACCTCCCCCGTCTCCGGGATCAACGGCGACATTCGGGCGAAGAAG ATTGCCAGCATCGCAGATGTGTGTGAGTCCATGAAGGAGCAGCTGCTGGTTCTCGTTGAG TGGGCCAAGTACATCCCAGCTTTCTGCGAGCTCCCCCTGGACGACCAGGTGGCCCTGCTC AGAGCCCATGCTGGCGAGCACCTGCTGCTCGGAGCCACCAAGAGATCCATGGTGTTCAAG GACGTGCTGCTCCTAGGCAATGACTACATTGTCCCTCGGCACTGCCCGGAGCTGGCGGAG ATGAGCCGGGTGTCCATACGCATCCTTGACGAGCTGGTGCTGCCCTTCCAGGAGCTGCAG ATCGATGACAATGAGTATGCCTACCTCAAAGCCATCATCTTCTTTGACCCAGATGCCAAG GGGCTGAGCGATCCAGGGAAGATCAAGCGGCTGCGTTCCCAGGTGCAGGTGAGCTTGGAG GACTACATCAACGACCGCCAGTATGACTCGCGTGGCCGCTTTGGAGAGCTGCTGCTGCTG CTGCCCACCTTGCAGAGCATCACCTGGCAGATGATCGAGCAGATCCAGTTCATCAAGCTC TTCGGCATGGCCAAGATTGACAACCTGTTGCAGGAGATGCTGCTGGGAGGTCCGTGCCAA GCCCAGGAGGGGCGGGGTTGGAGTGGGGACTCCCCAGGAGACAGGCCTCACACAGTGAGC TCACCCCTCAGCTCCTTGGCTTCCCCACTGTGCCGCTTTGGGCAAGTTGCTTAA |
Restriction Sites | Please inquire |
ACCN | NM_178850 |
Insert Size | 1250 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_178850.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_178850.1, NP_849181.1 |
RefSeq Size | 1600 bp |
RefSeq ORF | 1254 bp |
Locus ID | 3172 |
UniProt ID | P41235 |
Cytogenetics | 20q13.12 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Nuclear Hormone Receptor, Transcription Factors |
Protein Pathways | Maturity onset diabetes of the young |
Gene Summary | The protein encoded by this gene is a nuclear transcription factor which binds DNA as a homodimer. The encoded protein controls the expression of several genes, including hepatocyte nuclear factor 1 alpha, a transcription factor which regulates the expression of several hepatic genes. This gene may play a role in development of the liver, kidney, and intestines. Mutations in this gene have been associated with monogenic autosomal dominant non-insulin-dependent diabetes mellitus type I. Alternative splicing of this gene results in multiple transcript variants encoding several different isoforms. [provided by RefSeq, Apr 2012] Transcript Variant: This variant (3) has a different 3' end that causes a frame-shift compared to variant 2. The resulting shorter isoform (3, also known as HNF4alpha3) has a distinct C-terminus compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217924 | HNF4A (Myc-DDK-tagged)-Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 3 |
USD 457.00 |
|
RC217924L1 | Lenti ORF clone of Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 3, Myc-DDK-tagged |
USD 757.00 |
|
RC217924L2 | Lenti ORF clone of Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 3, mGFP tagged |
USD 757.00 |
|
RC217924L3 | Lenti ORF clone of Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 3, Myc-DDK-tagged |
USD 757.00 |
|
RC217924L4 | Lenti ORF clone of Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 3, mGFP tagged |
USD 757.00 |
|
RG217924 | HNF4A (tGFP-tagged) - Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 3 |
USD 657.00 |
{0} Product Review(s)
Be the first one to submit a review