C20orf79 (SCP2D1) (NM_178483) Human Untagged Clone

CAT#: SC307192

SCP2D1 (untagged)-Human chromosome 20 open reading frame 79 (C20orf79)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: C20orf79
• Synonyms: C20orf79; dJ1068E13.2; HSD22
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_178483 edited
  GATGGCAAGGTCCAGGGGACTAGCACAGGAAGATGTGGAAGAGAAGTGACCATCAACCCA
  AGATCAAAGCAGAGGATGGACCTCTGGTGGGCCAGTTCGAGGTTCTGGGTTCAGTTCCAG
  AACCTGCCATGCCACATCCTCTAGAGCTGTCAGAATTTGAGAGCTTCCCAGTGTTTCAGG
  ACATTAGGCTTCACATCAGGGAAGTGGGAGCTCAATTGGTCAAGAAAGTCAATGCCGTCT
  TTCAGCTGGACATCACCAAAAATGGGAAGACCATTTTGCGGTGGACCATTGATCTGAAGA
  ATGGTTCTGGGGACATGTATCCGGGACCTGCCAGGCTCCCAGCAGACACTGTCTTTACAA
  TCCCGGAGTCTGTCTTTATGGAGCTGGTTTTGGGCAAAATGAACCCGCAGAAGGCTTTCC
  TTGCCGGAAAGTTCAAAGTGAGTGGCAAGGTTCTGCTTAGCTGGAAGCTGGAAAGGGTTT
  TCAAAGACTGGGCTAAATTTTAAGCATGCAAAAATACCAAGGAAGAACTTCTCTTCGATG
  ATAATGTCGAGTGGAAATCATGCTTAATCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_178483
• Insert Size: 600 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_178483.2.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_178483.2, NP_848578.1
• RefSeq Size: 677 bp
• RefSeq ORF: 471 bp
• Locus ID: 140856
• UniProt ID: Q9UJQ7
• Cytogenetics: 20p11.23