SPTLC1 (NM_178324) Human Untagged Clone

CAT#: SC307151

SPTLC1 (untagged)-Human serine palmitoyltransferase, long chain base subunit 1 (SPTLC1), transcript variant 2


  "NM_178324" in other vectors (4)

Reconstitution Protocol

USD 240.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit Polyclonal Anti-SPTLC1 Antibody
    • 100 ul

USD 380.00

Other products for "SPTLC1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SPTLC1
Synonyms HSAN1; HSN1; LBC1; LCB1; SPT1; SPTI
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_178324, the custom clone sequence may differ by one or more nucleotides
ATGGCGACCGCCACGGAGCAGTGGGTTCTGGTGGAGATGGTACAGGCGCTTTACGAGGCT
CCTGCTTACCATCTTATTTTGGAAGGGATTCTGATCCTCTGGATAATCAGACTTCTTTTC
TCTAAGACTTACAAATTACAAGAACGATCTGATCTTACAGTCAAGGAAAAAGAAGAACTG
ATTGAAGAGTGGCAACCAGAACCTCTTGTTCCTCCTGTCCCAAAAGACCATCCTGCTCTC
AACTACAACATCGTTTCAGGCCCTCCAAGCCACAAAACTGTGGTGAATGGAAAAGAATGT
ATAAACTTCGCCTCATTTAATTTTCTTGGATTGTTGGATAACCCTAGGGTTAAGGCAGCA
GCTTTAGCATCTCTAAAGAAGTATGGCGTGGGGACTTGTGGACCCAGAGGATTTTATGGC
ACATTTGAATGA
Restriction Sites Please inquire     
ACCN NM_178324
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_178324.1, NP_847894.1
RefSeq Size 998 bp
RefSeq ORF 432 bp
Locus ID 10558
UniProt ID O15269
Cytogenetics 9q22.31
Protein Families Druggable Genome, Transmembrane
Protein Pathways Metabolic pathways, Sphingolipid metabolism
Gene Summary This gene encodes a member of the class-II pyridoxal-phosphate-dependent aminotransferase family. The encoded protein is the long chain base subunit 1 of serine palmitoyltransferase. Serine palmitoyltransferase converts L-serine and palmitoyl-CoA to 3-oxosphinganine with pyridoxal 5'-phosphate and is the key enzyme in sphingolipid biosynthesis. Mutations in this gene were identified in patients with hereditary sensory neuropathy type 1. Alternatively spliced variants encoding different isoforms have been identified. Pseudogenes of this gene have been defined on chromosomes 1, 6, 10, and 13. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) lacks several exons and its 3'-terminal exon extends past a splice site that is used in variant 1. The encoded isoform (b) has a shorter and distinct C-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.