Rex1 (ZFP42) (NM_174900) Human Untagged Clone

CAT#: SC306953

ZFP42 (untagged)-Human zinc finger protein 42 homolog (mouse) (ZFP42)


  "NM_174900" in other vectors (6)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


ZFP42 mouse monoclonal antibody, clone OTI3H9 (formerly 3H9)
    • 100 ul

USD 447.00

Other products for "ZFP42"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZFP42
Synonyms REX-1; REX1; zfp-42; ZNF754
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC306953 representing NM_174900.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCCAGCAACTGAAGAAACGGGCAAAGACAAGACACCAGAAAGGCCTGGGTGGAAGAGCCCCCAGT
GGGGCTAAGCCCAGGCAAGGCAAGTCAAGCCAAGACCTGCAGGCGGAAATAGAACCTGTCAGCGCGGTG
TGGGCCTTATGTGATGGCTATGTGTGCTATGAGCCTGGCCCTCAGGCTCTCGGAGGGGATGATTTCTCA
GACTGTTACATAGAATGCGTCATAAGGGGTGAGTTTTCTCAACCCATCCTGGAAGAGGACTCACTTTTT
GAGTCCTTGGAATACCTAAAGAAAGGATCAGAACAACAGCTTTCTCAAAAGGTTTTCGAAGCAAGCTCC
CTTGAATGTTCTTTGGAATACATGAAAAAAGGGGTAAAGAAAGAGCTTCCACAAAAGATAGTTGGAGAG
AATTCGCTTGAGTATTCTGAGTACATGACAGGCAAGAAGCTTCCGCCTGGAGGAATACCTGGCATTGAC
CTATCAGATCCTAAACAGCTCGCAGAATTTGCTAGAAAGAAGCCCCCCATAAATAAAGAATATGACAGT
CTGAGCGCAATCGCTTGTCCTCAGAGTGGATGCACTAGGAAGTTGAGGAATAGAGCTGCCCTGAGAAAG
CATCTCCTCATTCATGGTCCCCGAGACCACGTCTGTGCGGAATGTGGGAAAGCGTTCGTTGAGAGCTCA
AAACTAAAGAGACATTTCCTGGTTCATACTGGAGAGAAGCCGTTTCGGTGCACTTTTGAAGGGTGCGGA
AAGCGCTTCTCTCTGGACTTTAATTTGCGTACGCACGTGCGCATCCACACGGGGGAGAAACGTTTCGTG
TGTCCCTTTCAAGGCTGCAACAGGAGGTTTATTCAGTCAAATAACCTGAAAGCCCACATCCTAACGCAT
GCAAATACGAACAAGAATGAACAAGAGGGAAAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_174900
Insert Size 933 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_174900.4
RefSeq Size 2660 bp
RefSeq ORF 933 bp
Locus ID 132625
UniProt ID Q96MM3
Cytogenetics 4q35.2
Protein Families Adult stem cells, Embryonic stem cells, ES Cell Differentiation/IPS, Stem cell - Pluripotency
MW 34.8 kDa
Gene Summary Involved in the reprogramming of X-chromosome inactivation during the acquisition of pluripotency. Required for efficient elongation of TSIX, a non-coding RNA antisense to XIST. Binds DXPas34 enhancer within the TSIX promoter. Involved in ES cell self-renewal (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.