KCNJ1 (NM_153764) Human Untagged Clone
CAT#: SC306658
KCNJ1 (untagged)-Human potassium inwardly-rectifying channel, subfamily J, member 1 (KCNJ1), transcript variant rom-k2
"NM_153764" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCNJ1 |
Synonyms | KIR1.1; ROMK; ROMK1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC306658 representing NM_153764
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTCAAACATCTTCGGAAATGGGTCGTCACTCGCTTTTTTGGGCATTCTCGGCAAAGAGCAAGGCTAG TCTCCAAAGATGGAAGGTGCAACATAGAATTTGGCAATGTGGAGGCACAGTCAAGGTTTATATTCTTTGT GGACATCTGGACAACGGTACTTGACCTCAAGTGGAGATACAAAATGACCATTTTCATCACAGCCTTCTTG GGGAGTTGGTTTTTCTTTGGTCTCCTGTGGTATGCAGTAGCGTACATTCACAAAGACCTCCCGGAATTCC ATCCTTCTGCCAATCACACTCCCTGTGTGGAGAATATTAATGGCTTGACCTCAGCTTTTCTGTTTTCTCT GGAGACTCAAGTGACCATTGGATATGGATTCAGGTGTGTGACAGAACAGTGTGCCACTGCCATTTTTCTG CTTATCTTTCAGTCTATACTTGGAGTTATAATCAATTCTTTCATGTGTGGGGCCATCTTAGCCAAGATCT CCAGGCCCAAAAAACGTGCCAAGACCATTACGTTCAGCAAGAACGCAGTGATCAGCAAACGGGGAGGGAA GCTTTGCCTCCTAATCCGAGTGGCTAATCTCAGGAAGAGCCTTCTTATTGGCAGTCACATTTATGGAAAG CTTCTGAAGACCACAGTCACTCCTGAAGGAGAGACCATTATTTTGGACCAGATCAATATCAACTTTGTAG TTGACGCTGGGAATGAAAATTTATTCTTCATCTCCCCATTGACAATTTACCATGTCATTGATCACAACAG CCCTTTCTTCCACATGGCAGCGGAGACCCTTCTCCAGCAGGACTTTGAATTAGTGGTGTTTTTAGATGGC ACAGTGGAGTCCACCAGTGCTACCTGCCAAGTCCGGACATCCTATGTCCCAGAGGAGGTGCTTTGGGGCT ACCGTTTTGCTCCCATAGTATCCAAGACAAAGGAAGGGAAATACCGAGTGGATTTCCATAACTTTAGCAA GACAGTGGAAGTGGAGACCCCTCACTGTGCCATGTGCCTTTATAATGAGAAAGATGTTAGAGCCAGGATG AAGAGAGGCTATGACAACCCCAACTTCATCTTGTCAGAAGTCAATGAAACAGATGACACCAAAATGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | Please inquire |
ACCN | NM_153764 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_153764.1, NP_722448.1 |
RefSeq Size | 2446 bp |
RefSeq ORF | 1119 bp |
Locus ID | 3758 |
UniProt ID | P48048 |
Cytogenetics | 11q24.3 |
Protein Families | Druggable Genome, Ion Channels: Potassium, Transmembrane |
Gene Summary | Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. It is activated by internal ATP and probably plays an important role in potassium homeostasis. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Mutations in this gene have been associated with antenatal Bartter syndrome, which is characterized by salt wasting, hypokalemic alkalosis, hypercalciuria, and low blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2, also known as rom-k2) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (b) is shorter at the N-terminus than isoform a. Variants 2, 4 and 5 all encode isoform b but differ in their 5' UTRs. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216647 | KCNJ1 (Myc-DDK-tagged)-Human potassium inwardly-rectifying channel, subfamily J, member 1 (KCNJ1), transcript variant rom-k2 |
USD 686.00 |
|
RC216647L1 | Lenti-ORF clone of KCNJ1 (Myc-DDK-tagged)-Human potassium inwardly-rectifying channel, subfamily J, member 1 (KCNJ1), transcript variant rom-k2 |
USD 986.00 |
|
RC216647L2 | Lenti-ORF clone of KCNJ1 (mGFP-tagged)-Human potassium inwardly-rectifying channel, subfamily J, member 1 (KCNJ1), transcript variant rom-k2 |
USD 986.00 |
|
RC216647L3 | Lenti-ORF clone of KCNJ1 (Myc-DDK-tagged)-Human potassium inwardly-rectifying channel, subfamily J, member 1 (KCNJ1), transcript variant rom-k2 |
USD 986.00 |
|
RC216647L4 | Lenti-ORF clone of KCNJ1 (mGFP-tagged)-Human potassium inwardly-rectifying channel, subfamily J, member 1 (KCNJ1), transcript variant rom-k2 |
USD 986.00 |
|
RG216647 | KCNJ1 (tGFP-tagged) - Human potassium inwardly-rectifying channel, subfamily J, member 1 (KCNJ1), transcript variant rom-k2 |
USD 886.00 |
{0} Product Review(s)
Be the first one to submit a review