PXT1 (NM_152990) Human Untagged Clone
CAT#: SC306529
PXT1 (untagged)-Human peroxisomal, testis specific 1 (PXT1)
"NM_152990" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PXT1 |
Synonyms | STEPP |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_152990 edited
TTCACCAAATAATTCACAAGTTGGCCATGCAGCTGAGACACATTGGGGACAACATTGATC ATAGGATGGTTCGAGAGGATCTTCAACAGGATGGCAGAGATGCACTAGATCATTTTGTCT TCTTTTTCTTTAGAAGAGTTCAGGTGTTGCTGCATTTTTTCTGGAACAACCATTTGCTGT AAAAGGAATGAAAGAGAACCTCGTCCTCAAACTAAAGGCCACAGAAATGGGCACTACCTC CTGGCCCACTCCCTGGGCACCATGCCCTCTGGTGACCTGTTGGCTCCACTCTTGTCACTC ATGTCCAGATCTGCAGTGCCAGCTTCTCCTTCTCGGTGACATGTCACCTCCCTGCCCCAA TCCTGGCTCCAACCCTCTCTGGAAAATCGAAGTGAAACATTTGTCTCTAATACTCAAATT CAACATATGGCTCATCTCATCTACCTTCCCATTTCCATGCCTAGAGGCCCCACTACTACC ACTAGCACCGTTGGGTGTTTCCTTCTCAGGCTCTGATTCTACAACATTTACGTTCTTTTC TCACCTTTGATCCCCTCACTCCTCTGTGACCCCCTTCAAGTCTTCCTTCACCACTCCAGT GTTTTCCCATACCACTCGACCCTGCATTGTACCAAGGGC |
Restriction Sites | Please inquire |
ACCN | NM_152990 |
Insert Size | 600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_152990.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_152990.2, NP_694535.1 |
RefSeq Size | 2121 bp |
RefSeq ORF | 156 bp |
Locus ID | 222659 |
UniProt ID | Q8NFP0 |
Cytogenetics | 6p21.31 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC206365 | PXT1 (Myc-DDK-tagged)-Human peroxisomal, testis specific 1 (PXT1) |
USD 150.00 |
|
RC206365L3 | Lenti ORF clone of Human peroxisomal, testis specific 1 (PXT1), Myc-DDK-tagged |
USD 450.00 |
|
RC206365L4 | Lenti ORF clone of Human peroxisomal, testis specific 1 (PXT1), mGFP tagged |
USD 450.00 |
|
RG206365 | PXT1 (tGFP-tagged) - Human peroxisomal, testis specific 1 (PXT1) |
USD 350.00 |
|
SC327732 | PXT1 (untagged)-Human peroxisomal testis specific 1 (PXT1) |
USD 647.00 |
{0} Product Review(s)
Be the first one to submit a review