CCL28 (NM_148672) Human Untagged Clone
CAT#: SC306320
CCL28 (untagged)-Human chemokine (C-C motif) ligand 28 (CCL28)
"NM_148672" in other vectors (5)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CCL28 |
Synonyms | CCK1; MEC; SCYA28 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC306320 representing NM_148672.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGCAGAGAGGACTCGCCATCGTGGCCTTGGCTGTCTGTGCGGCCCTACATGCCTCAGAAGCCATA CTTCCCATTGCCTCCAGCTGTTGCACGGAGGTTTCACATCATATTTCCAGAAGGCTCCTGGAAAGAGTG AATATGTGTCGCATCCAGAGAGCTGATGGGGATTGTGACTTGGCTGCTGTCATCCTTCATGTCAAGCGC AGAAGAATCTGTGTCAGCCCGCACAACCATACTGTTAAGCAGTGGATGAAAGTGCAAGCTGCCAAGAAA AATGGTAAAGGAAATGTTTGCCACAGGAAGAAACACCATGGCAAGAGGAACAGTAACAGGGCACATCAG GGGAAACACGAAACATACGGCCATAAAACTCCTTATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_148672 |
Insert Size | 384 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_148672.3 |
RefSeq Size | 3126 bp |
RefSeq ORF | 384 bp |
Locus ID | 56477 |
UniProt ID | Q9NRJ3 |
Cytogenetics | 5p12 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
MW | 14.3 kDa |
Gene Summary | This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for resting CD4 or CD8 T cells and eosinophils. The product of this gene binds to chemokine receptors CCR3 and CCR10. This chemokine may play a role in the physiology of extracutaneous epithelial tissues, including diverse mucosal organs. Multiple transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (1) encodes the longer isoform (a). Variants 1, 2, and 3 all encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209344 | CCL28 (Myc-DDK-tagged)-Human chemokine (C-C motif) ligand 28 (CCL28) |
USD 150.00 |
|
RC209344L3 | Lenti ORF clone of Human chemokine (C-C motif) ligand 28 (CCL28), Myc-DDK-tagged |
USD 450.00 |
|
RC209344L4 | Lenti ORF clone of Human chemokine (C-C motif) ligand 28 (CCL28), mGFP tagged |
USD 450.00 |
|
RG209344 | CCL28 (tGFP-tagged) - Human chemokine (C-C motif) ligand 28 (CCL28) |
USD 350.00 |
|
SC321137 | CCL28 (untagged)-Human chemokine (C-C motif) ligand 28 (CCL28) |
USD 150.00 |
{0} Product Review(s)
Be the first one to submit a review