CRB3 (NM_139161) Human Untagged Clone

CAT#: SC306121

CRB3 (untagged)-Human crumbs homolog 3 (Drosophila) (CRB3), transcript variant 2


  "NM_139161" in other vectors (4)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


CRB3 Antibody - N-terminal region
    • 100 ul

USD 539.00

Other products for "CRB3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CRB3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_139161 edited
ACCGAGGGTTCGAGGGAGGGACACGGACCAGGAACCTGAGCTAGGTCAAAGACGCCCGGG
CCAGGTGCCCCGTCGCAGGTGCCCCTGGCCGGAGATGCGGTAGGAGGGGCGAGCGCGAGA
AGCCCCTTCCTCGGCGCTGCCAACCCGCCACCCAGCCCATGGCGAACCCCGGGCTGGGGC
TGCTTCTGGCGCTGGGCCTGCCGTTCCTGCTGGCCCGCTGGGGCCGAGCCTGGGGGCAAA
TACAGACCACTTCTGCAAATGAGAATAGCACTGTTTTGCCTTCATCCACCAGCTCCAGCT
CCGATGGCAACCTGCGTCCRGAAGCCATCACTGCTATCATCGTGGTCTTCTCCCTCTTGG
CTGCCTTGCTCCTGGCTGTGGGGCTGGCACTGTTGGTGCGGAAGCTTCGGGAGAAGCGGC
AGACGGAGGGCACCTACCGGCCCAGTAGCGAGGAGCAGGTGGGTGCCCGCGTGCCACCGA
CCCCCAACCTCAAGTTGCCGCCGGAAGAGCGGCTCATCTGATTCTCCCATGCAGCCGAGG
CCCGGGCCCCTCAGGACTCCAAGGAGACGGTGCAGGGCTGCCTGCCCATCTAGGTCCCCT
CTCCTGCATCTGTCTCCCTTCATTGCTGTGTGACCTTGGGGAAAGGCAGTGCCCTCTCTG
GGCAGTCAGATCCACCCAGTGCTTAATAGCAGGGAAGAAGGTACTTCAAAGACTCTGCCC
CTGAGGTCAAGAGAGGATGGGGCTATTCACTTTTATATATTTATATAAAATTAGTAGTGA
GATGTAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_139161
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_139161.3, NP_631900.1
RefSeq Size 1118 bp
RefSeq ORF 363 bp
Locus ID 92359
UniProt ID Q9BUF7
Cytogenetics 19p13.3
Protein Families Transmembrane
Protein Pathways Tight junction
Gene Summary This gene encodes a member of the Crumbs family of proteins. This gene is widely expressed in epithelial tissues where the encoded protein isoforms play various roles such as the control of cytokinesis and ciliogenesis or the formation of tight junctions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.