ATP6V1G3 (NM_133262) Human Untagged Clone
CAT#: SC305936
ATP6V1G3 (untagged)-Human ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 (ATP6V1G3), transcript variant 1
"NM_133262" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ATP6V1G3 |
Synonyms | ATP6G3; Vma10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305936 representing NM_133262.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACAAGCCAGTCTCAGGGGATCCACCAGCTTCTTCAGGCAGAAAAACGGGCCAAGGACAAGCTAGAG GAAGCCAAGAAGAGAAAAGGAAAGCGATTGAAGCAAGCCAAGGAGGAAGCAATGGTAGAAATTGACCAG TACAGAATGCAGAGAGATAAAGAGTTTCGACTAAAACAATCTAAGATAATGGGCTCTCAGAATAATCTC TCAGATGAAATAGAAGAACAAACACTAGGGAAGATACAAGAACTTAATGGACACTACAATAAGTATATG GAAAGTGTGATGAACCAGCTCTTGAGCATGGTCTGTGACATGAAACCAGAAATCCATGTGAACTACAGA GCCACCAACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_133262 |
Insert Size | 357 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_133262.2 |
RefSeq Size | 645 bp |
RefSeq ORF | 357 bp |
Locus ID | 127124 |
UniProt ID | Q96LB4 |
Cytogenetics | 1q31.3 |
Protein Pathways | Epithelial cell signaling in Helicobacter pylori infection, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection |
MW | 13.9 kDa |
Gene Summary | This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'' and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three G subunit proteins. Transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) lacks an alternate in-frame exon in the 5' coding region, compared to variant 3. It encodes isoform a, which lacks an internal segment and is shorter, compared to isoform c. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221453 | ATP6V1G3 (Myc-DDK-tagged)-Human ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 (ATP6V1G3), transcript variant 1 |
USD 150.00 |
|
RC221453L3 | Lenti ORF clone of Human ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 (ATP6V1G3), transcript variant 1, Myc-DDK-tagged |
USD 450.00 |
|
RC221453L4 | Lenti ORF clone of Human ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 (ATP6V1G3), transcript variant 1, mGFP tagged |
USD 450.00 |
|
RG221453 | ATP6V1G3 (tGFP-tagged) - Human ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 (ATP6V1G3), transcript variant 1 |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review