BHLHE23 (NM_080606) Human Untagged Clone

CAT#: SC305800

BHLHE23 (untagged)-Human basic helix-loop-helix family, member e23 (BHLHE23)


  "NM_080606" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "BHLHE23"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BHLHE23
Synonyms bA305P22.3; Beta3b; BETA4; BHLHB4
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_080606 edited
TGATTGGACAGCAGCGAGGTCCCACCGGGCGCCTCCGCGGCTTAAAACCGAAGCGGGGGC
GAGGGGGAGGTAGAGCCCGCCCCCTGCGCGTCGCGGCTGGGAGGGAGAGGAGGTGGGAGA
GAAGGAAGAGGCGGAGGAGGCAGCGGGCGCCGAGGCTCTGGGACCCGCAGGCAAGCCAGA
CCGACGCGCAGAGCCGGGAGCCTCATCGCAGCGGCAGCGGCAGCGGCGGGCTCGGGCCGG
CCTCGGGGGCTGCTCACCCACATGAGCATCCGCCCACCCGGCGAGCCCCCGAGCCCAGGC
GGCGCGGCCATGGCCGAGCTCAAGTCGCTGTCGGGGGACGCGTACCTGGCACTAAGCCAC
GGCTACGCGGCGGCGGCTGCGGGTCTCGCCTACGGGGCGGCGCGAGAACCCGAAGCGGCC
CGCGGCTACGGCACTCCGGGCCCGGGCGGCGACCTCCCCGCGGCGCCTGCACCTCGCGCC
CCAGCTCAGGCGGCGGAGAGCAGCGGCGAACAGAGCGGGGACGAGGACGACGCCTTCGAG
CAGCGGCGGCGGCGGCGCGGGCCAGGGAGCGCGGCGGACGGGCGGCGGCGGCCGCGAGAG
CAGCGGTCTCTGCGGCTCAGCATCAACGCGCGCGAGCGGCGGCGCATGCACGACCTAAAC
GACGCGCTGGACGGGCTGCGAGCCGTCATCCCCTACGCGCACAGCCCGTCGGTGCGCAAG
CTCTCCAAGATCGCCACGCTGCTGCTCGCCAAGAACTATATCCTCATGCAGGCGCAGGCC
CTGGACGAGATGCGGCGCCTGGTGGCCTTCCTCAACCAGGGCCAGGGCCTGGCCGCGCCC
GTAAACGCCGCGCCCTTGACGCCCTTCGGCCAGGCCACTGTGTGCCCCTTCTCCGCAGGC
GCCGCCCTGGGGCCCTGCCCTGACAAGTGCGCCGCCTTCTCCGGGACGCCCTCCGCGCTT
TGCAAACACTGTCACGAGAAGCCGTGACCGCGCGGGCCCCCGGCCCTCCCGCACGCGTCC
TCCGATCGCCCCTGTGACTGTCTCTCTGCCCGGACAG
Restriction Sites Please inquire     
ACCN NM_080606
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_080606.2, NP_542173.1
RefSeq Size 942 bp
RefSeq ORF 678 bp
Locus ID 128408
UniProt ID Q8NDY6
Cytogenetics 20q13.33
Gene Summary This gene encodes a member of the basic helix-loop-helix transcription factor family. Members of this family contain two highly conserved and functionally distinct domains: the basic domain targets sequence-specific DNA binding, while the helix-loop-helix domain facilitates protein interaction. Studies of a related gene in mouse suggest that the encoded protein may function as a transcriptional repressor in the pancreas and brain, and that it is required for normal retinal function. [provided by RefSeq, May 2013]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.