BAFF Receptor (TNFRSF13C) (NM_052945) Human Untagged Clone

CAT#: SC305701

TNFRSF13C (untagged)-Human tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C)


  "NM_052945" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-TNFRSF13C Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "BAFF Receptor"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BAFF Receptor
Synonyms BAFF-R; BAFFR; BROMIX; CD268; CVID4; prolixin
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_052945 edited
ATGAGGCGAGGGCCCCGGAGCCTGCGGGGCAGGGACGCGCCAGCCCCCACGCCCTGCGTC
CCGGCCGAGTGCTTCGACCTGCTGGTCCGCCACTGCGTGGCCTGCGGGCTCCTGCGCACG
CCGCGGCCGAAACCGGCCGGGGCCAGCAGCCCTGCGCCCAGGACGGCGCTGCAGCCGCAG
GAGTCGGTGGGCGCGGGGGCCGGCGAGGCGGCGCTGCCCCTGCCCGGGCTGCTCTTTGGC
GCCCCCGCGCTGCTGGGCCTGGCACTGGTCCTGGCGCTGGTCCTGGTGGGTCTGGTGAGC
TGGAGGCGGCGACAGCGGCGGCTTCGCGGCGCGTCCTCCGCAGAGGCCCCCGACGGAGAC
AAGGACGCCCCAGAGCCCCTGGACAAGGTCATCATTCTGTCTCCGGGAATCTCTGATGCC
ACAGCTCCTGCCTGGCCTCCTCCTGGGGAAGACCCAGGAACCACCCCACCTGGCCACAGT
GTCCCTGTGCCAGCCACAGAGCTGGGCTCCACTGAACTGGTGACCACCAAGACGGCCGGC
CCTGAGCAACAATAG
Restriction Sites Please inquire     
ACCN NM_052945
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_052945.2, NP_443177.1
RefSeq Size 898 bp
RefSeq ORF 555 bp
Locus ID 115650
UniProt ID Q96RJ3
Cytogenetics 22q13.2
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Primary immunodeficiency
Gene Summary B cell-activating factor (BAFF) enhances B-cell survival in vitro and is a regulator of the peripheral B-cell population. Overexpression of Baff in mice results in mature B-cell hyperplasia and symptoms of systemic lupus erythematosus (SLE). Also, some SLE patients have increased levels of BAFF in serum. Therefore, it has been proposed that abnormally high levels of BAFF may contribute to the pathogenesis of autoimmune diseases by enhancing the survival of autoreactive B cells. The protein encoded by this gene is a receptor for BAFF and is a type III transmembrane protein containing a single extracellular cysteine-rich domain. It is thought that this receptor is the principal receptor required for BAFF-mediated mature B-cell survival. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.