IDI2 (NM_033261) Human Untagged Clone
CAT#: SC305604
IDI2 (untagged)-Human isopentenyl-diphosphate delta isomerase 2 (IDI2)
"NM_033261" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IDI2 |
Synonyms | IPPI2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305604 representing NM_033261.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCTGACATAAATCTTGACTGGGTTGACAGGCGTCAGTTGCAGCGCTTGGAGGAAATGCTGATTGTT GTGGATGAGAATGATAAGGTTATTGGTGCCGACACCAAGAGGAATTGCCATCTGAACGAAAACATTGAG AAAGGGCTGCTGCACCGAGCCTTCAGCGTTGTCTTGTTTAACACCAAGAATCGAATCCTGATACAGCAG AGGTCGGACACGAAAGTCACGTTTCCTGGGTATTTTACCGACTCCTGTAGTAGCCACCCATTATACAAC CCAGCAGAACTGGAAGAAAAGGATGCCATCGGAGTGAGGAGGGCAGCCCAGAGGCGTCTGCAAGCAGAG CTGGGAATTCCTGGGGAGCAGATTTCTCCAGAGGACATTGTGTTCATGACAATCTATCACCACAAGGCA AAATCAGACAGAATTTGGGGAGAGCATGAAATTTGTTACCTTCTGCTTGTGAGGAAAAACGTCACTCTG AACCCGGATCCCAGTGAAACGAAAAGCATCCTCTACCTGTCCCAGGAGGAGCTGTGGGAGCTGCTGGAG AGGGAGGCGAGGGGTGAAGTCAAAGTCACCCCCTGGCTAAGAACCATTGCCGAGAGGTTTCTGTACCGG TGGTGGCCTCACCTGGATGACGTGACCCCGTTTGTGGAGCTTCACAAAATACACAGAGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_033261 |
Insert Size | 684 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_033261.2 |
RefSeq Size | 1359 bp |
RefSeq ORF | 684 bp |
Locus ID | 91734 |
UniProt ID | Q9BXS1 |
Cytogenetics | 10p15.3 |
Protein Pathways | Metabolic pathways, Terpenoid backbone biosynthesis |
MW | 26.8 kDa |
Gene Summary | The protein encoded by this gene catalyzes the conversion of isopentenyl diphosphate to dimethylallyl diphosphate, which is a precursor for the synthesis of cholesterol and other isoprenoids. This gene, which is a product of an ancestral gene duplication event, encodes a protein that may be involved in the aggregation of alpha-synuclein in the cerebral cortex of patients with Lewy body disease. In addition, segmental copy number gains in this locus have been associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204632 | IDI2 (Myc-DDK-tagged)-Human isopentenyl-diphosphate delta isomerase 2 (IDI2) |
USD 300.00 |
|
RC204632L3 | Lenti ORF clone of Human isopentenyl-diphosphate delta isomerase 2 (IDI2), Myc-DDK-tagged |
USD 600.00 |
|
RC204632L4 | Lenti ORF clone of Human isopentenyl-diphosphate delta isomerase 2 (IDI2), mGFP tagged |
USD 600.00 |
|
RG204632 | IDI2 (tGFP-tagged) - Human isopentenyl-diphosphate delta isomerase 2 (IDI2) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review