C1orf135 (AUNIP) (NM_024037) Human Untagged Clone

CAT#: SC305093

AUNIP (untagged)-Human chromosome 1 open reading frame 135 (C1orf135)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: C1orf135
• Synonyms: AIBP; C1orf135
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC305093 representing NM_024037.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAGGCGGACAGGCCCCGAGGAGGAGGCCTGCGGCGTGTGGCTGGACGCGGCGGCGCTGAAGAGGCGG
  AAAGTGCAGACACATTTAATCAAACCAGGCACCAAAATGCTAACACTCCTTCCTGGAGAAAGAAAGGCT
  AATATTTATTTTACTCAAAGAAGAGCTCCATCTACAGGCATTCACCAGAGAAGCATTGCTTCCTTCTTC
  ACCTTGCAGCCAGGAAAGACAAATGGCAGTGACCAGAAGAGTGTTTCATCTCATACAGAAAGTCAGATC
  AACAAAGAGTCCAAGAAAAATGCGACCCAGCTAGACCATTTGATCCCAGGCTTAGCACACGATTGCATG
  GCATCCCCTTTAGCCACTTCAACCACTGCAGACATCCAGGAAGCTGGACTCTCTCCTCAGTCCCTCCAG
  ACTTCTGGCCACCACAGAATGAAAACCCCATTTTCAACTGAGCTATCTTTGCTCCAGCCTGATACTCCA
  GACTGTGCTGGAGATAGTCATACCCCACTGGCTTTTTCCTTCACCGAGGACTTGGAAAGTTCTTGTTTG
  CTAGACCGAAAGGAAGAAAAAGGGGATTCTGCCAGGAAATGGGAATGGCTTCATGAGTCTAAGAAGAAC
  TATCAGAGTATGGAGAAACACACCAAACTACCTGGGGACAAATGCTGTCAGCCCTTAGGCAAGACTAAA
  TTGGAAAGAAAGGTGTCTGCCAAAGAAAACAGGCAGGCCCCTGTCCTCCTTCAAACATACAGGGAATCC
  TGGAATGGAGAAAACATAGAATCAGTGAAACAAAGCCGTAGTCCAGTTTCTGTGTTTTCCTGGGACAAT
  GAAAAGAATGACAAGGACTCCTGGAGTCAACTTTTCACTGAAGATTCTCAAGGCCAGCGGGTCATTGCC
  CACAACACTAGAGCTCCTTTTCAAGATGTAACCAATAACTGGAATTGGGACTTAGGGCCGTTTCCTAAC
  AGTCCTTGGGCTCAGTGCCAGGAGGATGGGCCAACTCAAAATCTGAAGCCTGATTTGCTCTTTACCCAG
  GACTCTGAAGGTAATCAAGTTATCAGACACCAATTCTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_024037
• Insert Size: 1074 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_024037.2
• RefSeq Size: 2178 bp
• RefSeq ORF: 1074 bp
• Locus ID: 79000
• UniProt ID: Q9H7T9
• Cytogenetics: 1p36.11
• MW: 40.3 kDa
• Gene Summary: DNA-binding protein that accumulates at DNA double-strand breaks (DSBs) following DNA damage and promotes DNA resection and homologous recombination (PubMed:29042561). Serves as a sensor of DNA damage: binds DNA with a strong preference for DNA substrates that mimic structures generated at stalled replication forks, and anchors RBBP8/CtIP to DSB sites to promote DNA end resection and ensuing homologous recombination repair (PubMed:29042561). Inhibits non-homologous end joining (NHEJ) (PubMed:29042561). Required for the dynamic movement of AURKA at the centrosomes and spindle apparatus during the cell cycle (PubMed:20596670).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) uses an alternate 3' terminal exon, compared to variant 1. It encodes isoform 2 which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.