TGF beta induced factor 2 (TGIF2) (NM_021809) Human Untagged Clone
CAT#: SC304959
TGIF2 (untagged)-Human TGFB-induced factor homeobox 2 (TGIF2), transcript variant 2
"NM_021809" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TGF beta induced factor 2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC304959 representing NM_021809.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGGACAGTGATCTAGGTGAGGACGAAGGCCTCCTCTCCCTGGCGGGCAAAAGGAAGCGCAGGGGG AACCTGCCCAAGGAGTCGGTGAAGATCCTCCGGGACTGGCTGTACTTGCACCGCTACAACGCCTACCCC TCAGAGCAGGAGAAGCTGAGCCTTTCTGGACAGACCAACCTGTCAGTGCTGCAAATATGTAACTGGTTC ATCAATGCCCGGCGGCGGCTTCTCCCAGACATGCTTCGGAAGGATGGCAAAGACCCTAATCAGTTTACC ATTTCCCGCCGCGGGGGTAAGGCCTCAGATGTGGCCCTCCCCCGTGGCAGCAGCCCCTCAGTGCTGGCT GTGTCTGTCCCAGCCCCCACCAATGTGCTCTCCCTGTCTGTGTGCTCCATGCCGCTTCACTCAGGCCAG GGGGAAAAGCCAGCAGCCCCTTTCCCACGTGGGGAGCTGGAGTCTCCCAAGCCCCTGGTGACCCCTGGT AGCACACTTACTCTGCTGACCAGGGCTGAGGCTGGAAGCCCCACAGGTGGACTCTTCAACACGCCACCA CCCACACCCCCAGAGCAGGACAAAGAGGACTTCAGCAGCTTCCAGCTGCTGGTGGAGGTGGCGCTACAG AGGGCTGCTGAGATGGAGCTTCAGAAGCAGCAGGACCCATCACTCCCATTACTGCACACTCCCATCCCT TTAGTCTCTGAAAATCCCCAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_021809 |
Insert Size | 714 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_021809.6 |
RefSeq Size | 3415 bp |
RefSeq ORF | 714 bp |
Locus ID | 60436 |
UniProt ID | Q9GZN2 |
Cytogenetics | 20q11.23 |
Protein Families | Transcription Factors |
MW | 25.9 kDa |
Gene Summary | The protein encoded by this gene is a DNA-binding homeobox protein and a transcriptional repressor, which appears to repress transcription by recruiting histone deacetylases to TGF beta-responsive genes. This gene is amplified and over-expressed in some ovarian cancers. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 1. Read-through transcription also exists between this gene and the neighboring downstream C20orf24 (chromosome 20 open reading frame 24) gene. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All variants (1-4) encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200773 | TGIF2 (Myc-DDK-tagged)-Human TGFB-induced factor homeobox 2 (TGIF2), transcript variant 2 |
USD 300.00 |
|
RC200773L3 | Lenti ORF clone of Human TGFB-induced factor homeobox 2 (TGIF2), transcript variant 2, Myc-DDK-tagged |
USD 600.00 |
|
RC200773L4 | Lenti ORF clone of Human TGFB-induced factor homeobox 2 (TGIF2), transcript variant 2, mGFP tagged |
USD 600.00 |
|
RG200773 | TGIF2 (tGFP-tagged) - Human TGFB-induced factor homeobox 2 (TGIF2), transcript variant 2 |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review