AMCase (CHIA) (NM_021797) Human Untagged Clone

CAT#: SC304955

CHIA (untagged)-Human chitinase, acidic (CHIA), transcript variant 2


  "NM_021797" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
CHIA mouse monoclonal antibody,clone OTI3H4
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "AMCase"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AMCase
Synonyms AMCASE; CHIT2; TSA1902
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_021797 edited
GTCTGGAACAGCCAGCTGAAAACTCTCCTGGCCATTGGAGGCTGGAACTTCGGGACTGCC
CCTTTCACTGCCATGGTTTCTACTCCTGAGAACCGCCAGACTTTCATCACCTCAGTCATC
AAATTCCTGCGCCAGTATGAGTTTGACGGGCTGGACTTTGACTGGGAGTACCCTGGCTCT
CGTGGGAGCCCTCCTCAGGACAAGCATCTCTTCACTGTCCTGGTGCAGGAAATGCGTGAA
GCTTTTGAGCAGGAGGCCAAGCAGATCAACAAGCCCAGGCTGATGGTCACTGCTGCAGTA
GCTGCTGGCATCTCCAATATCCAGTCTGGCTATGAGATCCCCCAACTGTCACAGTACCTG
GACTACATCCATGTCATGACCTACGACCTCCATGGCTCCTGGGAGGGCTACACTGGAGAG
AACAGCCCCCTCTACAAATACCCGACTGACACCGGCAGCAACGCCTACCTCAATGTGGAT
TATGTCATGAACTACTGGAAGGACAATGGAGCACCAGCTGAGAAGCTCATCGTTGGATTC
CCTACCTATGGACACAACTTCATCCTGAGCAACCCCTCCAACACTGGAATTGGTGCCCCC
ACCTCTGGTGCTGGTCCTGCTGGGCCCTATGCCAAGGAGTCTGGGATCTGGGCTTACTAC
GAGATCTGTACCTTCCTGAAAAATGGAGCCACTCAGGGATGGGATGCCCCTCAGGAAGTG
CCTTATGCCTATCAGGGCAATGTGTGGGTTGGCTATGACAACATCAAGAGCTTCGATATT
AAGGCTCAATGGCTTAAGCACAACAAATTTGGAGGCGCCATGGTCTGGGCCATTGATCTG
GATGACTTCACTGGCACTTTCTGCAACCAGGGCAAGTTTCCCCTAATCTCCACCCTGAAG
AAGGCCCTCGGCCTGCAGAGTGCAAGTTGCACGGCTCCAGCTCAGCCCATTGAGCCAATA
ACTGCTGCTCCCAGTGGCAGCGGGAACGGGAGCGGGAGTAGCAGCTCTGGAGGCAGCTCG
GGAGGCAGTGGATTCTGTGCTGTCAGAGCCAACGGCCTCTACCCCGTGGCAAATAACAGA
AATGCCTTCTGGCACTGCGTGAATGGAGTCACGTACCAGCAGAACTGCCAGGCCGGGCTT
GTCTTCGACACCAGCTGTGATTGCTGCAACTGGGCATAAACCTGACCTGGTCTATATTCC
CTAGAGTTCCAGTCTCTTTTGCTTAGGACATGTTGCCCCTACCTAAAGTCCTGCAATATT
Restriction Sites Please inquire     
ACCN NM_021797
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_021797.2, NP_068569.2
RefSeq Size 1360 bp
RefSeq ORF 1107 bp
Locus ID 27159
UniProt ID Q9BZP6
Cytogenetics 1p13.2
Protein Families Secreted Protein
Protein Pathways Amino sugar and nucleotide sugar metabolism
Gene Summary The protein encoded by this gene degrades chitin, which is found in the cell wall of most fungi as well as in arthropods and some nematodes. The encoded protein can also stimulate interleukin 13 expression, and variations in this gene can lead to asthma susceptibility. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (2) lacks exons in the 5' coding region and initiates translation at a downstream AUG compared to variant 4. The encoded isoform (a, also known as TSA1902-L) has a shorter N-terminus and lacks a signal peptide compared to isoform c. Variants 2, 5, and 7 all encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.