GHRH (NM_021081) Human Untagged Clone

CAT#: SC304905

GHRH (untagged)-Human growth hormone releasing hormone (GHRH), transcript variant 1


  "NM_021081" in other vectors (4)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit anti-GHRH Polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "GHRH"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GHRH
Synonyms GHRF; GRF; INN
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_021081 edited
ATGCCACTCTGGGTGTTCTTCTTTGTGATCCTCACCCTCAGCAACAGCTCCCACTGCTCC
CCACCTCCCCCTTTGACCCTCAGGATGCGGCGGTATGCAGATGCCATCTTCACCAACAGC
TACCGGAAGGTGCTGGGCCAGCTGTCCGCCCGCAAGCTGCTCCAGGACATCATGAGCAGG
CAGCAGGGAGAGAGCAACCAAGAGCGAGGAGCAAGGGCACGGCTTGGTCGTCAGGTAGAC
AGCATGTGGGCAGAACAAAAGCAAATGGAATTGGAGAGCATCCTGGTGGCCCTGCTGCAG
AAGCACAGCAGGAACTCCCAGGGATGAAGATTCCTCCTGTGACCCGGGCTACCTGTAGCC
AAAATGCAACTGGATCCAGTT
Restriction Sites Please inquire     
ACCN NM_021081
Insert Size 400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021081.3.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021081.3, NP_066567.1
RefSeq Size 454 bp
RefSeq ORF 327 bp
Locus ID 2691
UniProt ID P01286
Cytogenetics 20q11.23
Protein Families Druggable Genome, Secreted Protein
Gene Summary This gene encodes a member of the glucagon family of proteins. The encoded preproprotein is produced in the hypothalamus and cleaved to generate the mature factor, known as somatoliberin, which acts to stimulate growth hormone release from the pituitary gland. Variant receptors for somatoliberin have been found in several types of tumors, and antagonists of these receptors can inhibit the growth of the tumors. Defects in this gene are a cause of dwarfism, while hypersecretion of the encoded protein is a cause of gigantism. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.