BATF3 (NM_018664) Human Untagged Clone
CAT#: SC304622
BATF3 (untagged)-Human basic leucine zipper transcription factor, ATF-like 3 (BATF3)
"NM_018664" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BATF3 |
Synonyms | JDP1; JUNDM1; SNFT |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_018664, the custom clone sequence may differ by one or more nucleotides
ATGTCGCAAGGGCTCCCGGCCGCCGGCAGCGTCCTGCAGAGGAGCGTCGCGGCGCCCGGGAACCAGCCGC AGCCGCAGCCGCAGCAGCAGAGCCCTGAGGATGATGACAGGAAGGTCCGAAGGAGAGAAAAAAACCGAGT TGCTGCTCAGAGAAGTCGGAAGAAGCAGACCCAGAAGGCTGACAAGCTCCATGAGGAATATGAGAGCCTG GAGCAAGAAAACACCATGCTGCGGAGAGAGATCGGGAAGCTGACAGAGGAGCTGAAGCACCTGACAGAGG CACTGAAGGAGCACGAGAAGATGTGCCCGCTGCTGCTCTGCCCTATGAACTTTGTGCCAGTGCCTCCCCG GCCGGACCCTGTGGCCGGCTGCTTGCCCCGATGA |
Restriction Sites | Please inquire |
ACCN | NM_018664 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_018664.1, NP_061134.1 |
RefSeq Size | 980 bp |
RefSeq ORF | 384 bp |
Locus ID | 55509 |
UniProt ID | Q9NR55 |
Cytogenetics | 1q32.3 |
Gene Summary | This gene encodes a member of the basic leucine zipper protein family. The encoded protein functions as a transcriptional repressor when heterodimerizing with JUN. The protein may play a role in repression of interleukin-2 and matrix metalloproteinase-1 transcription.[provided by RefSeq, Feb 2009] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215000 | BATF3 (Myc-DDK-tagged)-Human basic leucine zipper transcription factor, ATF-like 3 (BATF3) |
USD 225.00 |
|
RC215000L1 | Lenti ORF clone of Human basic leucine zipper transcription factor, ATF-like 3 (BATF3), Myc-DDK-tagged |
USD 525.00 |
|
RC215000L2 | Lenti ORF clone of Human basic leucine zipper transcription factor, ATF-like 3 (BATF3), mGFP tagged |
USD 525.00 |
|
RC215000L3 | Lenti ORF clone of Human basic leucine zipper transcription factor, ATF-like 3 (BATF3), Myc-DDK-tagged |
USD 525.00 |
|
RC215000L4 | Lenti ORF clone of Human basic leucine zipper transcription factor, ATF-like 3 (BATF3), mGFP tagged |
USD 525.00 |
|
RG215000 | BATF3 (tGFP-tagged) - Human basic leucine zipper transcription factor, ATF-like 3 (BATF3) |
USD 425.00 |
{0} Product Review(s)
Be the first one to submit a review