LENEP (NM_018655) Human Untagged Clone
CAT#: SC304619
LENEP (untagged)-Human lens epithelial protein (LENEP)
"NM_018655" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LENEP |
Synonyms | LEP503 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_018655, the custom clone sequence may differ by one or more nucleotides
ATGCAGCCCCGGACACAGCCCCTAGCCCAAACCCTACCCTTCTTCCTCGGAGGGGCCCCT CGAGACACTGGGCTGCGGGTGCCTGTCATTAAGATGGGCACAGGGTGGGAGGGCTTCCAG CGGACCCTGAAGGAAGTCGCCTACATCCTCCTCTGCTGCTGGTGTATCAAGGAACTGCTG GATTAA |
Restriction Sites | Please inquire |
ACCN | NM_018655 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_018655.2, NP_061125.1 |
RefSeq Size | 671 bp |
RefSeq ORF | 186 bp |
Locus ID | 55891 |
UniProt ID | Q9Y5L5 |
Cytogenetics | 1q21.3 |
Gene Summary | The ocular lens is a tissue of epithelial origin and devoid of blood vessels and nerves. Cells of the lens epithelium are responsible for the growth and maintenance of the lens through mitosis, protein synthesis, and active transport of ions and metabolites across the lens capsule. Lens epithelial protein is expressed exclusively in lens epithelial cells and may play a role in cell differentiation. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217784 | LENEP (Myc-DDK-tagged)-Human lens epithelial protein (LENEP) |
USD 150.00 |
|
RC217784L3 | Lenti-ORF clone of LENEP (Myc-DDK-tagged)-Human lens epithelial protein (LENEP) |
USD 450.00 |
|
RC217784L4 | Lenti-ORF clone of LENEP (mGFP-tagged)-Human lens epithelial protein (LENEP) |
USD 450.00 |
|
RG217784 | LENEP (tGFP-tagged) - Human lens epithelial protein (LENEP) |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review