NODAL (NM_018055) Human Untagged Clone

CAT#: SC304557

NODAL (untagged)-Human nodal homolog (mouse) (NODAL)


  "NM_018055" in other vectors (6)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "NODAL"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NODAL
Synonyms HTX5
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_018055 edited
GAATTCGCCCTTATAAGGGCTGGAGGTGCTGCTTTCAGGCCTGGCCAGCCCACCATGCAC
GCCCACTGCCTGCCCTTCCTTCTGCACGCCTGGTGGGCCCTACTCCAGGCGGGTGCTGCG
ACGGTGGCCACTGCGCTCCTGCGTACGCGGGGGCAGCCCTCGTCGCCATCCCCTCTGGCG
TACATGCTGAGCCTCTACCGCGACCCGCTGCCGAGGGCAGACATCATCCGCAGCCTACAG
GCAGAAGATGTGGCAGTGGATGGGCAGAACTGGACGTTTGCTTTTGACTTCTCCTTCCTG
AGCCAACAAGAGGATCTGGCATGGGCTGAGCTCCGGCTGCAGCTGTCCAGCCCTGTGGAC
CTCCCCACTGAGGGCTCACTTGCCATTGAGATTTTCCACCAGCCAAAGCCCGACACAGAG
CAGGCTTCAGACAGCTGCTTAGAGCGGTTTCAGATGGACCTATTCACTGTCACTTTGTCC
CAGGTCACCTTTTCCTTGGGCAGCATGGTTTTGGAGGTGACCAGGCCTCTCTCCAAGTGG
CTGAAGCGCCCTGGGGCCCTGGAGAAGCAGATGTCCAGGGTAGCTGGAGAGTGCTGGCCG
CGGCCCCCCACACCGCCTGCCACCAATGTGCTCCTTATGCTCTACTCCAACCTCTCGCAG
GAGCAGAGGCAGCTGGGTGGGTCCACCTTGCTGTGGGAAGCCGAGAGCTCCTGGCGGGCC
CAGGAGGGACAGCTGTCCTGGGAGTGGGGCAAGAGGCACCGTCGACATCACTTGCCAGAC
AGAAGTCAACTGTGTCGGAAGGTCAAGTTCCAGGTGGACTTCAACCTGATCGGATGGGGC
TCCTGGATCATCTACCCCAAGCAGTACAACGCCTATCGCTGTGAGGGCGAGTGTCCTAAT
CCTGTTGGGGAGGAGTTTCATCCGACCAACCATGCATACATCCAGAGTCTGCTGAAACGT
TACCAGCCCCACCGAGTCCCTTCCACTTGTTGTGCCCCAGTGAAGACCAAGCCGCTGAGC
ATGCTGTATGTGGATAATGGCAGAGTGCTCCTAGATCACCATAAAGACATGATCGTGGAA
GAATGTGGGTGCCTCTGATGACATCCTGGAGGGAGACTGGATTTGCCTGCACTCTGGAAG
GCTGGGAAACTCCTGGAAGACATGATAACCATCTAATCCAGTAAGGAGAAACAGAGAGGG
GCAAAGTTGCTCTGCCCACCAGAACTGAAGAGGAGGGGCTGCCCACTCTGTAAATGAAGG
GCTCAGTGGAGTCTGGCCAAGCACAGAGGCTGCTGT
Restriction Sites Please inquire     
ACCN NM_018055
Insert Size 1300 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_018055.3, NP_060525.2
RefSeq Size 1744 bp
RefSeq ORF 1044 bp
Locus ID 4838
UniProt ID Q96S42
Cytogenetics 10q22.1
Protein Families Cancer stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Secreted Protein, Stem cell relevant signaling - TGFb/BMP signaling pathway
Protein Pathways TGF-beta signaling pathway
Gene Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which regulates early embryonic development. This protein is required for maintenance of human embryonic stem cell pluripotency and may play a role in human placental development. Mutations in this gene are associated with heterotaxy, a condition characterized by random orientation of visceral organs with respect to the left-right axis. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.