DEC1 (NM_017418) Human Untagged Clone
CAT#: SC304460
41609 (untagged)-Human deleted in esophageal cancer 1 (DEC1)
"NM_017418" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DEC1 |
Synonyms | CTS9 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC304460 representing NM_017418.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACAATGAATGTTCTGGAGGCTGGGAAGTGGAAGAGCATTGTGCCAGCACCTGGTGAGGGCCTTCTT GCCGTGTTACACATGATGGTTTTTACTGATGCCCTGCACAGAGAGAGGTCTGTAAAGTGGCAAGCAGGA GTCTGCTACAATGGAGGAAAGGATTTTGCTGTATCTCTTGCCAGGCCCAAGGCTGCAGAGGGAATTGCA GATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_017418 |
Insert Size | 213 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_017418.2 |
RefSeq Size | 1251 bp |
RefSeq ORF | 213 bp |
Locus ID | 50514 |
Cytogenetics | 9q33.1 |
MW | 7.5 kDa |
Gene Summary | The function of this gene is not known. This gene is located in a region commonly deleted in esophageal squamous cell carcinomas. Gene expression is reduced or absent in these carcinomas and thus this is a candidate tumor suppressor gene for esophageal squamous cell carcinomas. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213429 | DEC1 (Myc-DDK-tagged)-Human deleted in esophageal cancer 1 (DEC1) |
USD 150.00 |
|
RC213429L3 | Lenti ORF clone of Human deleted in esophageal cancer 1 (DEC1), Myc-DDK-tagged |
USD 450.00 |
|
RC213429L4 | Lenti ORF clone of Human deleted in esophageal cancer 1 (DEC1), mGFP tagged |
USD 450.00 |
|
RG213429 | 41609 (tGFP-tagged) - Human deleted in esophageal cancer 1 (DEC1) |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review