KIR2DS5 (NM_014513) Human Untagged Clone
CAT#: SC304120
KIR2DS5 (untagged)-Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 5 (KIR2DS5)
"NM_014513" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KIR2DS5 |
Synonyms | CD158G; NKAT9 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC304120 representing NM_014513.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGCTCATGGTCATCAGCATGGCGTGTGTTGCGTTCTTCTTGCTGCAGGGGGCCTGGCCACATGAG GGATTCCGCAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGAAATCAGAAGAGACAGTCATC CTGCAATGTTGGTCAGATGTCATGTTTGAGCACTTCCTTCTGCACAGAGAGGGGACGTTTAACCACACT TTGCGCCTCATTGGAGAGCACATTGATGGGGTCTCCAAGGGCAACTTCTCCATCGGTCGCATGACACAA GACCTGGCAGGGACCTACAGATGCTACGGTTCTGTTACTCACTCCCCCTATCAGTTGTCAGCGCCCAGT GACCCTCTGGACATCGTGATCACAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACG GTTCTGGCAGGAGAGAGCGTGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATGTACCATCTATCC AGGGAAGGGGAGGCCCATGAACGTAGGCTCCCTGCAGGGCCCAAGGTCAACAGAACATTCCAGGCCGAC TTTCCTCTGGACCCTGCCACCCACGGAGGGACCTACAGATGCTTCGGCTCTTTCCGTGACTCTCCATAC GAGTGGTCAAAGTCAAGTGACCCACTGCTTGTTTCTGTCACAGGAAACTCTTCAAATAGTTGGCCTTCA CCCACTGAACCAAGCTCCGAAACCGGTAACCCCAGACACCTACACGTTCTGATTGGGACCTCAGTGGTC AAACTCCCTTTCACCATCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCAACAAAAAAAATGCATCT GTAATGGACCAAGGGCCTGCGGGGAACAGAACAGTGAACAGGGAGGATTCTGATGAACAGGACCATCAG GAGGTGTCATACGCATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_014513 |
Insert Size | 915 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_014513.2 |
RefSeq Size | 1602 bp |
RefSeq ORF | 915 bp |
Locus ID | 3810 |
UniProt ID | Q14953 |
Cytogenetics | 19q13.4 |
Protein Families | Transmembrane |
Protein Pathways | Antigen processing and presentation, Natural killer cell mediated cytotoxicity |
MW | 33.7 kDa |
Gene Summary | Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212212 | KIR2DS5 (Myc-DDK-tagged)-Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 5 (KIR2DS5) |
USD 300.00 |
|
RC212212L1 | Lenti ORF clone of Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 5 (KIR2DS5), Myc-DDK-tagged |
USD 600.00 |
|
RC212212L2 | Lenti ORF clone of Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 5 (KIR2DS5), mGFP tagged |
USD 600.00 |
|
RC212212L3 | Lenti ORF clone of Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 5 (KIR2DS5), Myc-DDK-tagged |
USD 600.00 |
|
RC212212L4 | Lenti ORF clone of Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 5 (KIR2DS5), mGFP tagged |
USD 600.00 |
|
RG212212 | KIR2DS5 (tGFP-tagged) - Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 5 (KIR2DS5) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review