ANKRD1 (NM_014391) Human Untagged Clone

CAT#: SC304093

ANKRD1 (untagged)-Human ankyrin repeat domain 1 (cardiac muscle) (ANKRD1)


  "NM_014391" in other vectors (7)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-ANKRD1 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "ANKRD1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ANKRD1
Synonyms ALRP; bA320F15.2; C-193; CARP; CVARP; MCARP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC304093 representing NM_014391.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGGTACTGAAAGTAGAGGAACTGGTCACTGGAAAGAAGAATGGCAATGGGGAGGCAGGGGAATTC
CTTCCTGAGGATTTCAGAGATGGAGAGTATGAAGCTGCTGTTACTTTAGAGAAGCAGGAGGATCTGAAG
ACACTTCTAGCCCACCCTGTGACCCTGGGGGAGCAACAGTGGAAAAGCGAGAAACAACGAGAGGCAGAG
CTCAAAAAGAAAAAACTAGAACAAAGATCAAAGCTTGAAAATTTAGAAGACCTTGAAATAATCATTCAA
CTGAAGAAAAGGAAAAAATACAGGAAAACTAAAGTTCCAGTTGTAAAGGAACCAGAACCTGAAATCATT
ACGGAACCTGTGGATGTGCCTACGTTTCTGAAGGCTGCTCTGGAGAATAAACTGCCAGTAGTAGAAAAA
TTCTTGTCAGACAAGAACAATCCAGATGTTTGTGATGAGTATAAACGGACAGCTCTTCATAGAGCATGC
TTGGAAGGACATTTGGCAATTGTGGAGAAGTTAATGGAAGCTGGAGCCCAGATCGAATTCCGTGATATG
CTTGAATCCACAGCCATCCACTGGGCAAGCCGTGGAGGAAACCTGGATGTTTTAAAATTGTTGCTGAAT
AAAGGAGCAAAAATTAGCGCCCGAGATAAGTTGCTCAGCACAGCGCTGCATGTGGCGGTGAGGACTGGC
CACTATGAGTGCGCGGAGCATCTTATCGCCTGTGAGGCAGACCTCAACGCCAAAGACAGAGAAGGAGAT
ACCCCGTTGCATGATGCGGTGAGACTGAACCGCTATAAGATGATCCGACTCCTGATTATGTATGGCGCG
GATCTCAACATCAAGAACTGTGCTGGGAAGACGCCGATGGATCTGGTGCTACACTGGCAGAATGGAACC
AAAGCAATATTCGACAGCCTCAGAGAGAACTCCTACAAGACCTCTCGCATAGCTACATTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_014391
Insert Size 960 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_014391.2
RefSeq Size 1994 bp
RefSeq ORF 960 bp
Locus ID 27063
UniProt ID Q15327
Cytogenetics 10q23.31
MW 36.3 kDa
Gene Summary The protein encoded by this gene is localized to the nucleus of endothelial cells and is induced by IL-1 and TNF-alpha stimulation. Studies in rat cardiomyocytes suggest that this gene functions as a transcription factor. Interactions between this protein and the sarcomeric proteins myopalladin and titin suggest that it may also be involved in the myofibrillar stretch-sensor system. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.