LCE2B (NM_014357) Human Untagged Clone
CAT#: SC304086
LCE2B (untagged)-Human late cornified envelope 2B (LCE2B)
"NM_014357" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LCE2B |
Synonyms | LEP10; SPRL1B; XP5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC304086 representing NM_014357.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCTTGCCAGCAAAACCAGCAGCAGTGCCAGCCCCCTCCCAAGTGTCCTCCCAAGTGTACCCCAAAA TGTCCACCTAAGTGTCCCCCTAAATGCCTGCCCCAGTGCCCAGCTCCATGTTCCCCTGCAGTCTCTTCT TGCTGTGGTCCCATCTCTGGGGGCTGCTGTGGTCCCAGCTCTGGGGGCTGCTGCAACTCTGGGGCTGGT GGCTGCTGCCTGAGCCACCACAGGCCCCGTCTCTTCCACCGGCGCCGGCACCAGAGCCCCGACTGCTGT GAGAGTGAACCTTCTGGGGGCTCTGGCTGCTGCCACAGCTCTGGGGGCTGCTGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_014357 |
Insert Size | 333 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_014357.4 |
RefSeq Size | 619 bp |
RefSeq ORF | 333 bp |
Locus ID | 26239 |
UniProt ID | O14633 |
Cytogenetics | 1q21.3 |
MW | 11.2 kDa |
Gene Summary | This gene is one of the at least 20 genes expressed during epidermal differentiation and located on chromosomal band 1q21. This gene is involved in epidermal differentiation, and it is expressed at high levels in normal and psoriatic skin, but not in cultured keratinocytes or in any other tested cell types or tissues. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219058 | LCE2B (Myc-DDK-tagged)-Human late cornified envelope 2B (LCE2B) |
USD 150.00 |
|
RC219058L3 | Lenti ORF clone of Human late cornified envelope 2B (LCE2B), Myc-DDK-tagged |
USD 450.00 |
|
RC219058L4 | Lenti ORF clone of Human late cornified envelope 2B (LCE2B), mGFP tagged |
USD 450.00 |
|
RG219058 | LCE2B (tGFP-tagged) - Human late cornified envelope 2B (LCE2B) |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review