DPS1 (PDSS1) (NM_014317) Human Untagged Clone

CAT#: SC304078

PDSS1 (untagged)-Human prenyl (decaprenyl) diphosphate synthase, subunit 1 (PDSS1)


  "NM_014317" in other vectors (6)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


DPS1 Rabbit monoclonal Antibody
    • 100 ul

USD 380.00

Other products for "DPS1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DPS1
Synonyms COQ1; COQ1A; COQ10D2; DPS; hDPS1; SPS; TPRT; TPT; TPT 1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_014317 edited
ATGGCCTCGCGCTGGTGGCGGTGGCGGCGCGGCTGCTCCTGGAAGCCGGCGGCGCGGAGC
CCCGGGCCCGGCTCCCCCGGCCGTGCGGGACCGTTGGGGCCGAGCGCCGCTGCCGAAGTC
CGCGCGCAGGTTCATAGGCGGAAGGGACTTGACTTGTCTCAGATACCCTATATTAATCTT
GTGAAGCATTTAACATCTGCCTGTCCAAATGTATGTCGTATATCACGGTTTCATCACACA
ACCCCAGACAGTAAAACACACAGTGGTGAAAAATACACCGATCCTTTCAAACTCGGTTGG
AGAGACTTGAAAGGTCTGTATGAGGACATTAGAAAGGAACTGCTTATATCAACATCAGAA
CTTAAGGAAATGTCTGAGTACTACTTTGATGGGAAAGGGAAAGCCTTTCGACCAATTATT
GTGGCGCTAATGGCCCGAGCATGCAATATTCATCATAACAACTCCCGACATGTGCAAGCC
AGCCAGCGCGCCATAGCCTTAATTGCAGAAATGATCCACACTGCTAGTCTGGTTCACGAT
GACGTTATTGACGATGCAAGTTCTCGAAGAGGAAAACACACAGTTAATAAGATCTGGGGT
GAAAAGAAGGCTGTTCTTGCTGGAGATTTAATTCTTTCTGCAGCATCTATAGCTCTGGCA
CGAATTGGAAATACAACTGTTATATCTATTTTAACCCAAGTTATTGAAGATTTGGTGCGT
GGTGAATTTCTTCAGCTCGGGTCAAAAGAAAATGAGAATGAAAGATTTGCACACTACCTT
GAGAAGACATTCAAGAAGACCGCCAGCCTGATAGCCAACAGTTGTAAAGCAGTCTCTGTT
CTAGGATGTCCCGACCCAGTGGTGCATGAGATCGCCTATCAGTACGGAAAAAATGTAGGA
ATAGCTTTTCAGCTAATAGATGATGTATTGGACTTCACCTCGTGTTCTGACCAGATGGGC
AAACCAACATCAGCTGATCTGAAGCTCGGGTTAGCCACTGGTCCTGTCCTGTTTGCCTGT
CAGCAGTTCCCAGAAATGAATGCTATGATCATGCGACGGTTCAGTTTGCCTGGAGATGTA
GACAGAGCTCGACAGTATGTACTACAGAGTGATGGTGTGCAACAAACAACCTACCTCGCC
CAGCAGTACTGCCATGAAGCAATAAGAGAGATCAGTAAACTTCGACCATCCCCAGAAAGA
GATGCCCTCATTCAGCTTTCAGAAATTGTACTCACAAGAGATAAATGA
Restriction Sites Please inquire     
ACCN NM_014317
Insert Size 1700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_014317.3, NP_055132.2
RefSeq Size 1679 bp
RefSeq ORF 1248 bp
Locus ID 23590
UniProt ID Q5T2R2
Cytogenetics 10p12.1
Protein Pathways Terpenoid backbone biosynthesis
Gene Summary The protein encoded by this gene is an enzyme that elongates the prenyl side-chain of coenzyme Q, or ubiquinone, one of the key elements in the respiratory chain. The gene product catalyzes the formation of all trans-polyprenyl pyrophosphates from isopentyl diphosphate in the assembly of polyisoprenoid side chains, the first step in coenzyme Q biosynthesis. The protein may be peripherally associated with the inner mitochondrial membrane, though no transit peptide has been definitively identified to date. Defects in this gene are a cause of coenzyme Q10 deficiency. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.