ALF (GTF2A1L) (NM_006872) Human Untagged Clone

CAT#: SC303835

GTF2A1L (untagged)-Human general transcription factor IIA, 1-like (GTF2A1L), transcript variant 1


  "NM_006872" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
GTF2A1L mouse monoclonal antibody,clone OTI1D3
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ALF
Synonyms ALF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303835 representing NM_006872.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCTGCCTCAACCCGGTGCCTAAACTCTACAGATCTGTAATTGAAGATGTAATTGAAGGAGTTCGG
AATCTATTTGCTGAAGAAGGTATAGAGGAACAAGTTTTAAAAGACTTGAAGCAGCTCTGGGAAACCAAG
GTTTTGCAGTCTAAAGCAACAGAAGACTTCTTCAGAAATAGCATCCAATCACCTCTGTTTACTCTTCAG
TTGCCGCACAGCTTGCACCAAACATTGCAATCGTCAACAGCATCATTAGTTATTCCTGCTGGTAGAACT
CTTCCAAGTTTTACCACAGCAGAACTGGGCACTTCAAACTCCAGTGCAAACTTTACTTTTCCTGGTTAT
CCCATTCATGTACCAGCAGGTGTGACACTACAGACTGTATCTGGTCACCTTTATAAAGTCAATGTACCA
ATTATGGTGACAGAGACTTCTGGAAGAGCAGGTATTCTTCAGCATCCAATTCAGCAAGTATTTCAACAG
CTTGGCCAGCCTTCAGTAATACAAACTAGTGTTCCACAATTGAATCCATGGTCTCTTCAAGCAACTACT
GAAAAATCACAGAGAATTGAAACCGTGCTACAGCAACCCGCAATTCTACCTTCTGGGCCAGTAGATAGG
AAACACTTAGAAAATGCCACCAGTGATATACTTGTATCTCCTGGAAATGAGCATAAAATCGTGCCTGAA
GCTTTGTTGTGTCATCAGGAAAGTTCTCACTATATCAGTCTTCCAGGTGTTGTATTTTCTCCACAGGTC
TCTCAAACAAATTCTAATGTGGAGTCAGTGCTCAGTGGTTCAGCTAGCATGGCTCAAAATCTGCATGAT
GAGTCCCTCTCCACAAGCCCTCATGGGGCTCTCCACCAGCACGTGACTGATATTCAGCTTCATATTCTT
AAAAATAGGATGTATGGATGTGATTCTGTAAAGCAACCAAGAAATATAGAGGAACCCAGCAACATACCT
GTATCAGAGAAGGATTCTAATTCTCAGGTGGATTTAAGCATTCGGGTTACTGATGATGATATTGGTGAA
ATAATTCAAGTAGATGGAAGCGGTGATACATCTTCCAATGAAGAAATAGGAAGTACAAGAGATGCAGAT
GAGAATGAATTTCTAGGGAATATTGACGGGGGAGATCTGAAGGTACCTGAAGAAGAAGCTGACAGTATT
TCAAATGAGGATTCAGCCACAAACAGTAGTGATAATGAAGACCCTCAAGTAAACATTGTAGAAGAGGAC
CCTTTAAATTCTGGAGATGATGTTAGTGAACAGGATGTGCCAGACCTGTTTGACACGGATAATGTTATT
GTCTGTCAGTATGATAAGATTCATCGAAGCAAGAACAAATGGAAATTCTATTTGAAAGATGGTGTTATG
TGTTTTGGAGGGAGAGACTATGTATTTGCAAAAGCCATTGGTGATGCAGAGTGGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_006872
Insert Size 1437 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006872.4
RefSeq Size 1710 bp
RefSeq ORF 1437 bp
Locus ID 11036
UniProt ID Q9UNN4
Cytogenetics 2p16.3
Protein Families Transcription Factors
Protein Pathways Basal transcription factors
MW 52.4 kDa
Gene Summary The assembly and stability of the RNA polymerase II transcription pre-initiation complex on a eukaryotic core promoter involve the effects of transcription factor IIA (TFIIA) on the interaction between TATA-binding protein (TBP) and DNA. This gene encodes a germ cell-specific counterpart of the large (alpha/beta) subunit of general transcription factor TFIIA that is able to stabilize the binding of TBP to DNA and may be uniquely important to testis biology. Alternative splicing for this locus has been observed and two variants, encoding distinct isoforms, have been identified. Co-transcription of this gene and the neighboring upstream gene generates a rare transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.