CD226 (NM_006566) Human Untagged Clone

CAT#: SC303792

CD226 (untagged)-Human CD226 molecule (CD226)


  "NM_006566" in other vectors (6)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Rabbit Polyclonal Anti-CD226 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CD226"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CD226
Synonyms DNAM-1; DNAM1; PTA1; TLiSA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303792 representing NM_006566.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATTATCCTACTTTACTTTTGGCTCTTCTTCATGTATACAGAGCTCTATGTGAAGAGGTGCTTTGG
CATACATCAGTTCCCTTTGCCGAGAACATGTCTCTAGAATGTGTGTATCCATCAATGGGCATCTTAACA
CAGGTGGAGTGGTTCAAGATCGGGACCCAGCAGGATTCCATAGCCATTTTCAGCCCTACTCATGGCATG
GTCATAAGGAAGCCCTATGCTGAGAGGGTTTACTTTTTGAATTCAACGATGGCTTCCAATAACATGACT
CTTTTCTTTCGGAATGCCTCTGAAGATGATGTTGGCTACTATTCCTGCTCTCTTTACACTTACCCACAG
GGAACTTGGCAGAAGGTGATACAGGTGGTTCAGTCAGATAGTTTTGAGGCAGCTGTGCCATCAAATAGC
CACATTGTTTCGGAACCTGGAAAGAATGTCACACTCACTTGTCAGCCTCAGATGACGTGGCCTGTGCAG
GCAGTGAGGTGGGAAAAGATCCAGCCCCGTCAGATCGACCTCTTAACTTACTGCAACTTGGTCCATGGC
AGAAATTTCACCTCCAAGTTCCCAAGACAAATAGTGAGCAACTGCAGCCACGGAAGGTGGAGCGTCATC
GTCATCCCCGATGTCACAGTCTCAGACTCGGGGCTTTACCGCTGCTACTTGCAGGCCAGCGCAGGAGAA
AACGAAACCTTCGTGATGAGATTGACTGTAGCCGAGGGTAAAACCGATAACCAATATACCCTCTTTGTG
GCTGGAGGGACAGTTTTATTGTTGTTGTTTGTTATCTCAATTACCACCATCATTGTCATTTTCCTTAAC
AGAAGGAGAAGGAGAGAGAGAAGAGATCTATTTACAGAGTCCTGGGATACACAGAAGGCACCCAATAAC
TATAGAAGTCCCATCTCTACCGGTCAACCTACCAATCAATCCATGGATGATACAAGAGAGGATATTTAT
GTCAACTATCCAACCTTCTCTCGCAGACCAAAGACTAGAGTTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_006566
Insert Size 1011 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_006566.1
RefSeq Size 2664 bp
RefSeq ORF 1011 bp
Locus ID 10666
UniProt ID Q15762
Cytogenetics 18q22.2
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cell adhesion molecules (CAMs)
MW 38.6 kDa
Gene Summary This gene encodes a glycoprotein expressed on the surface of NK cells, platelets, monocytes and a subset of T cells. It is a member of the Ig-superfamily containing 2 Ig-like domains of the V-set. The protein mediates cellular adhesion of platelets and megakaryocytic cells to vascular endothelial cells. The protein also plays a role in megakaryocytic cell maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 2 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.