Eotaxin 3 (CCL26) (NM_006072) Human Untagged Clone

CAT#: SC303732

CCL26 (untagged)-Human chemokine (C-C motif) ligand 26 (CCL26)


  "NM_006072" in other vectors (6)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Anti-CCL26 Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Eotaxin 3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Eotaxin 3
Synonyms IMAC; MIP-4a; MIP-4alpha; SCYA26; TSC-1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_006072 edited
CAGGCAGGAGGAGTTTGGGAGAAACCTGAGAAGGGCCTGATTTGCAGCATCATGATGGGC
CTCTCCTTGGCCTCTGCTGTGCTCCTGGCCTCCCTCCTGAGTCTCCACCTTGGAACTGCC
ACACGTGGGAGTGACATATCCAAGACCTGCTGCTTCCAATACAGCCACAAGCCCCTTCCC
TGGACCTGGGTGCGAAGCTATGAATTCACCAGTAACAGCTGCTCCCAGCGGGCTGTGATA
TTCACTACCAAAAGAGGCAAGAAAGTCTGTACCCATCCAAGGAAAAAATGGGTGCAAAAA
TACATTTCTTTACTGAAAACTCCGAAACAATTGTGACTCAGCTGAATTGTCATCCGAGGA
CGCTTGGACCCCGCTCTTGGCTCTGC
>OriGene 5' read for NM_006072 unedited
NGGAAGGTCAGATTTGTTTACGACTTATATAGGCGGCCGCGCATTCANATCTGGTACCGG
GCCCCCCCNTCGGGTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGG
ATCCGCCCAGGCAGGAGGAGTTTGGGAGAAACCTGAGAAGGGCCTGATTTGCAGCATCAT
GATGGGCCTCTCCTTGGCCTCTGCTGTGCTCCTGGCCTCCCTCCTGAGTCTCCACCTTGG
AACTGCCACACGTGGGAGTGACATATCCAAGACCTGCTGCTTCCAATACAGCCACAAGCC
CCTTCCCTGGACCTGGGTGCGAAGCTATGAATTCACCAGTAACAGCTGCTCCCAGCGGGC
TGTGATATTCACTACCAAAAGAGGCAAGAAAGTCTGTACCCATCCAAGGAAAAAATGGGT
GCAAAAATACATTTCTTTACTGAAAACTCCGAAACAATTGTGACTCAGCTGAATTGTCAT
CCGAGGACGCTTGGACCCCGCTCTTGGCTCTGCGGGCTAGAGCGGCCGCGGTCATAGCTG
TTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCC
TGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATAAGTTGCATCATTTT
GTCTGACTAGGTGTCCTTCTATAATATTATGGNGTGGAAGGGGGTGGTATGGAGCAAGGG
CAAGTTGGGAAAACAACCTGTTAGGCCTGCGGGGTCTATTGGGAACCCAAGCTGAGTGCA
GTGGCCCAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGGCT
TAACCTTCCCGATTTGTTGGGATTCCGGCCTGCCTGGACCGGGTTAAGTTAATTTTGGTT
TTTTG
Restriction Sites Please inquire     
ACCN NM_006072
Insert Size 400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_006072.4, NP_006063.1
RefSeq Size 562 bp
RefSeq ORF 285 bp
Locus ID 10344
UniProt ID Q9Y258
Cytogenetics 7q11.23
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction
Gene Summary This gene is one of two Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 7. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for normal peripheral blood eosinophils and basophils. This protein also has antimicrobial activity, displaying an antibacterial effect on S. pneumoniae, S. aureus, Non-typeable H. influenzae, and P. aeruginosa. The product of this gene is one of three related chemokines that specifically activate chemokine receptor CCR3. This chemokine may contribute to the eosinophil accumulation in atopic diseases. [provided by RefSeq, Jul 2020]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.