CCN6 (NM_003880) Human Untagged Clone

CAT#: SC303396

WISP3 (untagged)-Human WNT1 inducible signaling pathway protein 3 (WISP3), transcript variant 1


  "NM_003880" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


CCN6 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "CCN6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CCN6
Synonyms LIBC; PPAC; PPD; PPRD; WISP-3; WISP3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303396 representing NM_003880.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGGGGCTCCTCTTCTCCACTCTTCTGCTTGCTGGCCTGGCACAGTTCTGCTGCAGGGTACAGGGC
ACTGGACCATTAGATACAACACCTGAAGGAAGGCCTGGAGAAGTGTCAGATGCACCTCAGCGTAAACAG
TTTTGTCACTGGCCCTGCAAATGCCCTCAGCAGAAGCCCCGTTGCCCTCCTGGAGTGAGCCTGGTGAGA
GATGGCTGTGGATGCTGTAAAATCTGTGCCAAGCAACCAGGGGAAATCTGCAATGAAGCTGACCTCTGT
GACCCACACAAAGGGCTGTATTGTGACTACTCAGTAGACAGGCCTAGGTACGAGACTGGAGTGTGTGCA
TACCTTGTAGCTGTTGGGTGCGAGTTCAACCAGGTACATTATCATAATGGCCAAGTGTTTCAGCCCAAC
CCCTTGTTCAGCTGCCTCTGTGTGAGTGGGGCCATTGGATGCACACCTCTGTTCATACCAAAGCTGGCT
GGCAGTCACTGCTCTGGAGCTAAAGGTGGAAAGAAGTCTGATCAGTCAAACTGTAGCCTGGAACCATTA
CTACAGCAGCTTTCAACAAGCTACAAAACAATGCCAGCTTATAGAAATCTCCCACTTATTTGGAAAAAA
AAATGTCTTGTGCAAGCAACAAAATGGACTCCCTGCTCCAGAACATGTGGGATGGGAATATCTAACAGG
GTGACCAATGAAAACAGCAACTGTGAAATGAGAAAAGAGAAAAGACTGTGTTACATTCAGCCTTGCGAC
AGCAATATATTAAAGACAATAAAGATTCCCAAAGGAAAAACATGCCAACCTACTTTCCAACTCTCCAAA
GCTGAAAAATTTGTCTTTTCTGGATGCTCAAGTACTCAGAGTTACAAACCCACTTTTTGTGGAATATGC
TTGGATAAGAGATGCTGTATCCCTAATAAGTCTAAAATGATTACTATTCAATTTGATTGCCCAAATGAG
GGGTCATTTAAATGGAAGATGCTGTGGATTACATCTTGTGTGTGTCAGAGAAACTGCAGAGAACCTGGA
GATATATTTTCTGAGCTCAAGATTCTGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_003880
Insert Size 1065 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003880.3
RefSeq Size 1252 bp
RefSeq ORF 1065 bp
Locus ID 8838
UniProt ID O95389
Cytogenetics 6q21
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein
MW 39.3 kDa
Gene Summary This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene is overexpressed in colon tumors. It may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Mutations of this gene are associated with progressive pseudorheumatoid dysplasia, an autosomal recessive skeletal disorder, indicating that the gene is essential for normal postnatal skeletal growth and cartilage homeostasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) has an alternate splice pattern near the 5' end and uses a downstream start codon, compared to variant 3. The resulting isoform (1) has a shorter N-terminus, compared to isoform 3.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.