I 309 (CCL1) (NM_002981) Human Untagged Clone

CAT#: SC303257

CCL1 (untagged)-Human chemokine (C-C motif) ligand 1 (CCL1)


  "NM_002981" in other vectors (6)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-CCL1 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "I 309"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol I 309
Synonyms I-309; P500; SCYA1; SISe; TCA3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_002981 edited
AAGCTGCTCCAGGAAGGCCCAAGCCAGACCAGAAGACATGCAGATCATCACCACAGCCCT
GGTGTGCTTGCTGCTAGCTGGGATGTGGCCGGAAGATGTGGACAGCAAGAGCATGCAGGT
ACCCTTCTCCAGATGTTGCTTCTCATTTGCGGAGCAAGAGATTCCCCTGAGGGCAATCCT
GTGTTACAGAAATACCAGCTCCATCTGCTCCAATGAGGGCTTAATATTCAAGCTGAAGAG
AGGCAAAGAGGCCTGCGCCTTGGACACAGTTGGATGGGTTCAGAGGCACAGAAAAATGCT
GAGGCACTGCCCGTCAAAAAGAAAATGAGCAGATTTCTTTCCATTGTGGGCTCTGGAAAC
CACATGGCTTCACCTGTCCCCGAA
>OriGene 5' read for NM_002981 unedited
GAGACTTGTATACGACTCCTATAGGGCGGCCGCGAATTCGCCCTTAAGCTGCTCCAGGAA
GGCCCAAGCCAGACCAGAAGACATGCAGATCATCACCACAGCCCTGGTGTGCTTGCTGCT
AGCTGGGATGTGGCCGGAAGATGTGGACAGCAAGAGCATGCAGGTACCCTTCTCCAGATG
TTGCTTCTCATTTGCGGAGCAAGAGATTCCCCTGAGGGCAATCCTGTGTTACAGAAATAC
CAGCTCCATCTGCTCCAATGAGGGCTTAATATTCAAGCTGAAGAGAGGCAAAGAGGCCTG
CGCCTTGGACACAGTTGGATGGGTTCAGAGGCACAGAAAAATGCTGAGGCACTGCCCGTC
AAAAAGAAAATGAGCAGATTTCTTTCCATTGTGGGCTCTGGAAACCACATGGCTTCACCT
GTCCCCGAACCGTGATGAAGGGCGAATTCAGATCTGGTACCGATATCAAGCTTGTCGACT
CTAGATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGA
CCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGT
CCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGG
GTGGAGGGGGTGGGTATGGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCG
GGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCATCTCCGC
CTCCTGGGTTCAAGCGATTCTCCTGCTCAGCCTCCGAGTTGTTGGATTCCAGGCATGCAT
GACCAGCTCAGCTAATTTTTGTTTTTTTGTAGAGACGGTTTCACCCATATTGGCCCAGCT
G
Restriction Sites Please inquire     
ACCN NM_002981
Insert Size 400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002981.1, NP_002972.1
RefSeq Size 542 bp
RefSeq ORF 291 bp
Locus ID 6346
UniProt ID P22362
Cytogenetics 17q12
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction
Gene Summary This antimicrobial gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, is secreted by activated T cells and displays chemotactic activity for monocytes but not for neutrophils. It binds to the chemokine (C-C motif) receptor 8. [provided by RefSeq, Sep 2014]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.