PF4V1 (NM_002620) Human Untagged Clone

CAT#: SC303229

PF4V1 (untagged)-Human platelet factor 4 variant 1 (PF4V1)


  "NM_002620" in other vectors (4)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal antibody to PF4V1 (platelet factor 4 variant 1)
    • 100 ul

USD 625.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PF4V1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PF4V1
Synonyms CXCL4L1; CXCL4V1; PF4-ALT; PF4A; SCYB4V1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_002620 edited
GGGATCCTGCTGGAACCTCAGCTGCAACATGAGCTCCGCAGCCAGGTCCCGCCTCACCCG
CGCCACCCGCCAGGAGATGCTGTTCTTGGCGTTGCTGCTCCTGCCAGTTGTGGTCGCCTT
CGCCAGAGCTGAAGCTGAAGAAGATGGGGACCTGCAGTGCCTGTGTGTGAAGACCACCTC
CCAGGTCCGTCCCAGGCACATCACCAGCCTGGAGGTGATCAAGGCCGGACCCCACTGCCC
CACTGCCCAACTCATAGCCACGCTGAAGAATGGGAGGAAAATTTGCTTGGATCTGCAAGC
CCTGCTGTACAAGAAAATCATTAAGGAACATTTGGAGAGTTAGCTACTAGCTGCCTAAGT
GTGCACTTTCAA
Restriction Sites Please inquire     
ACCN NM_002620
Insert Size 400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002620.1, NP_002611.1
RefSeq Size 755 bp
RefSeq ORF 315 bp
Locus ID 5197
UniProt ID P10720
Cytogenetics 4q13.3
Protein Families Secreted Protein
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction
Gene Summary The protein encoded by this gene is a chemokine that is highly similar to platelet factor 4. The encoded protein displays a strong antiangiogenic function and is regulated by chemokine (C-X-C motif) receptor 3. This protein also impairs tumor growth and can protect against blood-retinal barrier breakdown in diabetes patients. [provided by RefSeq, Nov 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.